FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631367_at:

>probe:Drosophila_2:1631367_at:683:211; Interrogation_Position=1319; Antisense; AAGACGCCGACCAGGTGTATCACAA
>probe:Drosophila_2:1631367_at:127:269; Interrogation_Position=1348; Antisense; CAGGAGTACCTTAAGCAGTTGGCTT
>probe:Drosophila_2:1631367_at:191:695; Interrogation_Position=1371; Antisense; TTTGCCTGCCGACAGCATTGATGAG
>probe:Drosophila_2:1631367_at:224:373; Interrogation_Position=1397; Antisense; GAAGTGTGCGTCTCATTTGCAAAGA
>probe:Drosophila_2:1631367_at:435:315; Interrogation_Position=1484; Antisense; GCCTGCTACCACTGGTTGAGGACAA
>probe:Drosophila_2:1631367_at:15:81; Interrogation_Position=1517; Antisense; AGGGCAACCTCACGGCATACAACTT
>probe:Drosophila_2:1631367_at:707:123; Interrogation_Position=1559; Antisense; AGCGCTTCCTCAGCGAGTGTGGCAA
>probe:Drosophila_2:1631367_at:76:85; Interrogation_Position=1574; Antisense; AGTGTGGCAACATTCCCGGCGAGTG
>probe:Drosophila_2:1631367_at:58:557; Interrogation_Position=1618; Antisense; GGACGTCTGAAGAGCATTGCCGCCA
>probe:Drosophila_2:1631367_at:613:7; Interrogation_Position=1633; Antisense; ATTGCCGCCAAGATGCTTAGCGATT
>probe:Drosophila_2:1631367_at:388:327; Interrogation_Position=1652; Antisense; GCGATTTGGGAATGCACGCCACCAT
>probe:Drosophila_2:1631367_at:337:121; Interrogation_Position=1678; Antisense; AGCGATGATGTTCTGCACGAGATTT
>probe:Drosophila_2:1631367_at:119:335; Interrogation_Position=1717; Antisense; GCTGAGTTGCATGCAGTGTCTGCTT
>probe:Drosophila_2:1631367_at:357:85; Interrogation_Position=1731; Antisense; AGTGTCTGCTTTTATTGGTGGCTGC

Paste this into a BLAST search page for me
AAGACGCCGACCAGGTGTATCACAACAGGAGTACCTTAAGCAGTTGGCTTTTTGCCTGCCGACAGCATTGATGAGGAAGTGTGCGTCTCATTTGCAAAGAGCCTGCTACCACTGGTTGAGGACAAAGGGCAACCTCACGGCATACAACTTAGCGCTTCCTCAGCGAGTGTGGCAAAGTGTGGCAACATTCCCGGCGAGTGGGACGTCTGAAGAGCATTGCCGCCAATTGCCGCCAAGATGCTTAGCGATTGCGATTTGGGAATGCACGCCACCATAGCGATGATGTTCTGCACGAGATTTGCTGAGTTGCATGCAGTGTCTGCTTAGTGTCTGCTTTTATTGGTGGCTGC

Full Affymetrix probeset data:

Annotations for 1631367_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720