FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631369_at:

>probe:Drosophila_2:1631369_at:30:539; Interrogation_Position=217; Antisense; GGTACGCTGCTTCGACTACTACATA
>probe:Drosophila_2:1631369_at:684:27; Interrogation_Position=239; Antisense; ATACCCATCATCAACGGGCTGTCGG
>probe:Drosophila_2:1631369_at:628:709; Interrogation_Position=294; Antisense; TTAAGGACTACGACACCGCCAGCGA
>probe:Drosophila_2:1631369_at:299:529; Interrogation_Position=369; Antisense; GGGATCGTGGCTGCAACACCTTCTT
>probe:Drosophila_2:1631369_at:483:85; Interrogation_Position=432; Antisense; AGTGCTTCGCCAACGTCGGAGCTGA
>probe:Drosophila_2:1631369_at:328:239; Interrogation_Position=466; Antisense; AATCATGTACCAAGTCTCGGCGAAT
>probe:Drosophila_2:1631369_at:696:299; Interrogation_Position=502; Antisense; CGCCGTCCAGATCAAGATCCATTTG
>probe:Drosophila_2:1631369_at:563:693; Interrogation_Position=523; Antisense; TTTGCAGACTTTGGACAGCCAGTTG
>probe:Drosophila_2:1631369_at:295:393; Interrogation_Position=548; Antisense; GAAAGCTGCTTGAACTATTCCGAAA
>probe:Drosophila_2:1631369_at:432:525; Interrogation_Position=586; Antisense; GGGCACCTCGCTCTACTATGGAGAA
>probe:Drosophila_2:1631369_at:652:551; Interrogation_Position=605; Antisense; GGAGAACTCAACAAATGCCTTGCTG
>probe:Drosophila_2:1631369_at:413:333; Interrogation_Position=626; Antisense; GCTGGAGCTCCAGTTCCGCAGGATA
>probe:Drosophila_2:1631369_at:537:27; Interrogation_Position=669; Antisense; ATACCACCGCCTAAAACCTGATAAG
>probe:Drosophila_2:1631369_at:540:167; Interrogation_Position=741; Antisense; AAATGTGTGCTTTCATGCTTTACAA

Paste this into a BLAST search page for me
GGTACGCTGCTTCGACTACTACATAATACCCATCATCAACGGGCTGTCGGTTAAGGACTACGACACCGCCAGCGAGGGATCGTGGCTGCAACACCTTCTTAGTGCTTCGCCAACGTCGGAGCTGAAATCATGTACCAAGTCTCGGCGAATCGCCGTCCAGATCAAGATCCATTTGTTTGCAGACTTTGGACAGCCAGTTGGAAAGCTGCTTGAACTATTCCGAAAGGGCACCTCGCTCTACTATGGAGAAGGAGAACTCAACAAATGCCTTGCTGGCTGGAGCTCCAGTTCCGCAGGATAATACCACCGCCTAAAACCTGATAAGAAATGTGTGCTTTCATGCTTTACAA

Full Affymetrix probeset data:

Annotations for 1631369_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720