FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631370_at:

>probe:Drosophila_2:1631370_at:281:93; Interrogation_Position=227; Antisense; AGTTCCACATTCTCAACAACCGAGC
>probe:Drosophila_2:1631370_at:168:163; Interrogation_Position=273; Antisense; AAATATCCACAACTTCGACAACCGA
>probe:Drosophila_2:1631370_at:548:155; Interrogation_Position=344; Antisense; ACAGCAATCATCACAACTACAGGAG
>probe:Drosophila_2:1631370_at:589:391; Interrogation_Position=371; Antisense; GAAACCTCCACAACTACAACGACAG
>probe:Drosophila_2:1631370_at:622:155; Interrogation_Position=404; Antisense; ACAGCTTCCACAACACAAGGCGATC
>probe:Drosophila_2:1631370_at:722:573; Interrogation_Position=422; Antisense; GGCGATCCAATATATCCGACTTACA
>probe:Drosophila_2:1631370_at:369:175; Interrogation_Position=499; Antisense; AAACCCCTGGATCTGGAACAATGGC
>probe:Drosophila_2:1631370_at:695:385; Interrogation_Position=514; Antisense; GAACAATGGCAATCCGGCAGTAAAA
>probe:Drosophila_2:1631370_at:44:433; Interrogation_Position=635; Antisense; GAGTGGGTTGGCATCCGACGACAAT
>probe:Drosophila_2:1631370_at:57:411; Interrogation_Position=651; Antisense; GACGACAATTTGTTACCGCTGCTGC
>probe:Drosophila_2:1631370_at:190:133; Interrogation_Position=665; Antisense; ACCGCTGCTGCTACTATGATCAAAA
>probe:Drosophila_2:1631370_at:663:235; Interrogation_Position=693; Antisense; AATCGCCGGATGCAGTAAAATTCAC
>probe:Drosophila_2:1631370_at:329:471; Interrogation_Position=728; Antisense; GTTCGTGGTACGATTATGCTCGATG
>probe:Drosophila_2:1631370_at:565:543; Interrogation_Position=752; Antisense; GGATATCACCGAATTTCTATGTCTA

Paste this into a BLAST search page for me
AGTTCCACATTCTCAACAACCGAGCAAATATCCACAACTTCGACAACCGAACAGCAATCATCACAACTACAGGAGGAAACCTCCACAACTACAACGACAGACAGCTTCCACAACACAAGGCGATCGGCGATCCAATATATCCGACTTACAAAACCCCTGGATCTGGAACAATGGCGAACAATGGCAATCCGGCAGTAAAAGAGTGGGTTGGCATCCGACGACAATGACGACAATTTGTTACCGCTGCTGCACCGCTGCTGCTACTATGATCAAAAAATCGCCGGATGCAGTAAAATTCACGTTCGTGGTACGATTATGCTCGATGGGATATCACCGAATTTCTATGTCTA

Full Affymetrix probeset data:

Annotations for 1631370_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720