FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631374_at:

>probe:Drosophila_2:1631374_at:511:335; Interrogation_Position=2639; Antisense; GCTCACTCATCTCATCGAAGCTATA
>probe:Drosophila_2:1631374_at:422:587; Interrogation_Position=2690; Antisense; TGGAGCGTTCGCAGAGACTTACAGA
>probe:Drosophila_2:1631374_at:622:241; Interrogation_Position=2722; Antisense; AATACGATTCCCGATAATGCCACCG
>probe:Drosophila_2:1631374_at:88:353; Interrogation_Position=2762; Antisense; GCAGCTCACTCACCAAATTCAATAT
>probe:Drosophila_2:1631374_at:95:31; Interrogation_Position=2785; Antisense; ATAAATTCAGCAAAGCCAGCCGCCG
>probe:Drosophila_2:1631374_at:181:463; Interrogation_Position=2815; Antisense; GATTCGCGTAGCACTGGCACAGATC
>probe:Drosophila_2:1631374_at:372:567; Interrogation_Position=2830; Antisense; GGCACAGATCCAAGTACACCACAGA
>probe:Drosophila_2:1631374_at:694:95; Interrogation_Position=2871; Antisense; AGATTTGAATTTCCCCTCAAGGTCG
>probe:Drosophila_2:1631374_at:567:223; Interrogation_Position=2889; Antisense; AAGGTCGTCGTCTCGCATATCCCAG
>probe:Drosophila_2:1631374_at:53:37; Interrogation_Position=2939; Antisense; ATCTTCCCCATTGCAGTGGCCAAAA
>probe:Drosophila_2:1631374_at:622:213; Interrogation_Position=2980; Antisense; AAGAGAGGATCACGCGAATCGCCGC
>probe:Drosophila_2:1631374_at:461:323; Interrogation_Position=3040; Antisense; GCGAAAATCGACTTTGACCAATCCG
>probe:Drosophila_2:1631374_at:39:647; Interrogation_Position=3070; Antisense; TCTTCCTCCTCATCGAACATATTTA
>probe:Drosophila_2:1631374_at:144:471; Interrogation_Position=3104; Antisense; GTTTTGAAATTTATGACCCTATCCT

Paste this into a BLAST search page for me
GCTCACTCATCTCATCGAAGCTATATGGAGCGTTCGCAGAGACTTACAGAAATACGATTCCCGATAATGCCACCGGCAGCTCACTCACCAAATTCAATATATAAATTCAGCAAAGCCAGCCGCCGGATTCGCGTAGCACTGGCACAGATCGGCACAGATCCAAGTACACCACAGAAGATTTGAATTTCCCCTCAAGGTCGAAGGTCGTCGTCTCGCATATCCCAGATCTTCCCCATTGCAGTGGCCAAAAAAGAGAGGATCACGCGAATCGCCGCGCGAAAATCGACTTTGACCAATCCGTCTTCCTCCTCATCGAACATATTTAGTTTTGAAATTTATGACCCTATCCT

Full Affymetrix probeset data:

Annotations for 1631374_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720