Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631375_a_at:

>probe:Drosophila_2:1631375_a_at:344:173; Interrogation_Position=331; Antisense; AAAGCAGCTTCTTTGGAGATTCAGA
>probe:Drosophila_2:1631375_a_at:711:709; Interrogation_Position=350; Antisense; TTCAGAAGCGGCAATGACGGCGACT
>probe:Drosophila_2:1631375_a_at:308:145; Interrogation_Position=372; Antisense; ACTGCGAGGCAGTCGGCAACATCGA
>probe:Drosophila_2:1631375_a_at:610:423; Interrogation_Position=395; Antisense; GAGAAAGCAACCTGCGATCGCAATG
>probe:Drosophila_2:1631375_a_at:399:611; Interrogation_Position=418; Antisense; TGCTCAATGGAAACGCTTTTACGGT
>probe:Drosophila_2:1631375_a_at:218:697; Interrogation_Position=434; Antisense; TTTTACGGTTAAGCGGCTCTTAGCG
>probe:Drosophila_2:1631375_a_at:247:707; Interrogation_Position=453; Antisense; TTAGCGCTGCTGATCATCTTCACAG
>probe:Drosophila_2:1631375_a_at:448:585; Interrogation_Position=481; Antisense; TGGACGCGAGTCGATCCCTGGAGCT
>probe:Drosophila_2:1631375_a_at:464:397; Interrogation_Position=510; Antisense; GACAAGTGCCAGCATGACATGGACT
>probe:Drosophila_2:1631375_a_at:511:401; Interrogation_Position=525; Antisense; GACATGGACTGCACGGATTTCATCA
>probe:Drosophila_2:1631375_a_at:415:141; Interrogation_Position=537; Antisense; ACGGATTTCATCAAGGGCAGCAGCT
>probe:Drosophila_2:1631375_a_at:342:465; Interrogation_Position=605; Antisense; GTTGGATTCCAAGCGCTGTTTGTCA
>probe:Drosophila_2:1631375_a_at:609:369; Interrogation_Position=677; Antisense; GAAGGTGGCCAATAGCAGTTGTCTG
>probe:Drosophila_2:1631375_a_at:314:435; Interrogation_Position=723; Antisense; GAGGGATTCCTGCAGTTCCGCAAGC

Paste this into a BLAST search page for me
AAAGCAGCTTCTTTGGAGATTCAGATTCAGAAGCGGCAATGACGGCGACTACTGCGAGGCAGTCGGCAACATCGAGAGAAAGCAACCTGCGATCGCAATGTGCTCAATGGAAACGCTTTTACGGTTTTTACGGTTAAGCGGCTCTTAGCGTTAGCGCTGCTGATCATCTTCACAGTGGACGCGAGTCGATCCCTGGAGCTGACAAGTGCCAGCATGACATGGACTGACATGGACTGCACGGATTTCATCAACGGATTTCATCAAGGGCAGCAGCTGTTGGATTCCAAGCGCTGTTTGTCAGAAGGTGGCCAATAGCAGTTGTCTGGAGGGATTCCTGCAGTTCCGCAAGC

Full Affymetrix probeset data:

Annotations for 1631375_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime