FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631376_at:

>probe:Drosophila_2:1631376_at:259:629; Interrogation_Position=480; Antisense; TCCGTATGGAGTGGGCCTTTTGGTC
>probe:Drosophila_2:1631376_at:357:37; Interrogation_Position=532; Antisense; ATCTATCAGGTCACGCCATCGGCGA
>probe:Drosophila_2:1631376_at:354:269; Interrogation_Position=548; Antisense; CATCGGCGACCTTTTTCAATTGCAA
>probe:Drosophila_2:1631376_at:396:615; Interrogation_Position=568; Antisense; TGCAAGGCCAATTCGATCGGATCGC
>probe:Drosophila_2:1631376_at:677:41; Interrogation_Position=583; Antisense; ATCGGATCGCGTTCACAGAGTGCAC
>probe:Drosophila_2:1631376_at:432:433; Interrogation_Position=600; Antisense; GAGTGCACGCACCTATCTGGAGAAG
>probe:Drosophila_2:1631376_at:239:141; Interrogation_Position=671; Antisense; ACGGAATTCGCGCTATACTCGGTAC
>probe:Drosophila_2:1631376_at:280:539; Interrogation_Position=691; Antisense; GGTACCCTGCCTACGGATGAGCAAG
>probe:Drosophila_2:1631376_at:625:447; Interrogation_Position=721; Antisense; GATGCCGGTCAGTATGACATCACTG
>probe:Drosophila_2:1631376_at:683:33; Interrogation_Position=739; Antisense; ATCACTGTGGCCATCGTCGGCAAAG
>probe:Drosophila_2:1631376_at:604:261; Interrogation_Position=766; Antisense; CAGCCATTCACAATTCTCTCTAATA
>probe:Drosophila_2:1631376_at:595:369; Interrogation_Position=825; Antisense; GAATGACAATGATACGCCCAGGAAC
>probe:Drosophila_2:1631376_at:178:373; Interrogation_Position=910; Antisense; GAAGTCCTGGTTGCAACCGAGCAGC
>probe:Drosophila_2:1631376_at:140:295; Interrogation_Position=927; Antisense; CGAGCAGCGTCCATAGGCATTTATA

Paste this into a BLAST search page for me
TCCGTATGGAGTGGGCCTTTTGGTCATCTATCAGGTCACGCCATCGGCGACATCGGCGACCTTTTTCAATTGCAATGCAAGGCCAATTCGATCGGATCGCATCGGATCGCGTTCACAGAGTGCACGAGTGCACGCACCTATCTGGAGAAGACGGAATTCGCGCTATACTCGGTACGGTACCCTGCCTACGGATGAGCAAGGATGCCGGTCAGTATGACATCACTGATCACTGTGGCCATCGTCGGCAAAGCAGCCATTCACAATTCTCTCTAATAGAATGACAATGATACGCCCAGGAACGAAGTCCTGGTTGCAACCGAGCAGCCGAGCAGCGTCCATAGGCATTTATA

Full Affymetrix probeset data:

Annotations for 1631376_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720