Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631377_a_at:

>probe:Drosophila_2:1631377_a_at:193:697; Interrogation_Position=1021; Antisense; TTTCTAGTGCACTTTTTAGCGCGAA
>probe:Drosophila_2:1631377_a_at:318:35; Interrogation_Position=599; Antisense; ATCACGCGGGCCAAGGGTAGCTCGA
>probe:Drosophila_2:1631377_a_at:400:531; Interrogation_Position=613; Antisense; GGGTAGCTCGAAGGGATTCCTCATC
>probe:Drosophila_2:1631377_a_at:480:9; Interrogation_Position=628; Antisense; ATTCCTCATCGATGGATATCCGCGT
>probe:Drosophila_2:1631377_a_at:518:681; Interrogation_Position=644; Antisense; TATCCGCGTCAGAAGAACCAGGGCA
>probe:Drosophila_2:1631377_a_at:36:275; Interrogation_Position=667; Antisense; CATTGAGTTCGAGGCGCGCATTGCA
>probe:Drosophila_2:1631377_a_at:456:41; Interrogation_Position=699; Antisense; ATCTGGCGCTGTACTTTGAGTGCTC
>probe:Drosophila_2:1631377_a_at:249:725; Interrogation_Position=714; Antisense; TTGAGTGCTCCGAGGACACGATGGT
>probe:Drosophila_2:1631377_a_at:300:423; Interrogation_Position=794; Antisense; GAGAAGACCATTAGGGCACGCCTCC
>probe:Drosophila_2:1631377_a_at:457:699; Interrogation_Position=855; Antisense; TTTATGAGCCCAAAACCCTTACGAT
>probe:Drosophila_2:1631377_a_at:160:455; Interrogation_Position=877; Antisense; GATCAATGCCGAGCGTGACGTGGAC
>probe:Drosophila_2:1631377_a_at:304:611; Interrogation_Position=892; Antisense; TGACGTGGACGACATCTTTCTGGAA
>probe:Drosophila_2:1631377_a_at:105:89; Interrogation_Position=916; Antisense; AGTCGTCCAGGCCATTGACTGTGTG
>probe:Drosophila_2:1631377_a_at:520:319; Interrogation_Position=965; Antisense; GCCGCCCAGTGCTAGTAGAATGCTA

Paste this into a BLAST search page for me
TTTCTAGTGCACTTTTTAGCGCGAAATCACGCGGGCCAAGGGTAGCTCGAGGGTAGCTCGAAGGGATTCCTCATCATTCCTCATCGATGGATATCCGCGTTATCCGCGTCAGAAGAACCAGGGCACATTGAGTTCGAGGCGCGCATTGCAATCTGGCGCTGTACTTTGAGTGCTCTTGAGTGCTCCGAGGACACGATGGTGAGAAGACCATTAGGGCACGCCTCCTTTATGAGCCCAAAACCCTTACGATGATCAATGCCGAGCGTGACGTGGACTGACGTGGACGACATCTTTCTGGAAAGTCGTCCAGGCCATTGACTGTGTGGCCGCCCAGTGCTAGTAGAATGCTA

Full Affymetrix probeset data:

Annotations for 1631377_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime