FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631378_at:

>probe:Drosophila_2:1631378_at:492:203; Interrogation_Position=2275; Antisense; AACCAGATACGCGATATACAAGCAA
>probe:Drosophila_2:1631378_at:225:29; Interrogation_Position=2290; Antisense; ATACAAGCAAAACGCCAGTTCATCA
>probe:Drosophila_2:1631378_at:699:313; Interrogation_Position=2303; Antisense; GCCAGTTCATCATAAATGCAACGAT
>probe:Drosophila_2:1631378_at:235:459; Interrogation_Position=2325; Antisense; GATATCTATTTGTTTGACTTTCCTA
>probe:Drosophila_2:1631378_at:4:403; Interrogation_Position=2340; Antisense; GACTTTCCTAGGATGGAGATGGTCA
>probe:Drosophila_2:1631378_at:23:423; Interrogation_Position=2355; Antisense; GAGATGGTCAGGAGGTTAACGCTTT
>probe:Drosophila_2:1631378_at:186:539; Interrogation_Position=2368; Antisense; GGTTAACGCTTTTGACAGCTTTCAA
>probe:Drosophila_2:1631378_at:682:459; Interrogation_Position=2399; Antisense; GATTTCTTGTATTTCTCATAATGCT
>probe:Drosophila_2:1631378_at:24:19; Interrogation_Position=2425; Antisense; ATTTAATTCCAAAACCTCTCCAGAG
>probe:Drosophila_2:1631378_at:723:305; Interrogation_Position=2439; Antisense; CCTCTCCAGAGATAATTTCCCAAAG
>probe:Drosophila_2:1631378_at:395:183; Interrogation_Position=2599; Antisense; AAAATTATAACATATTGCGCCTAAA
>probe:Drosophila_2:1631378_at:484:623; Interrogation_Position=2614; Antisense; TGCGCCTAAATGTATTTGCCCCAAA
>probe:Drosophila_2:1631378_at:116:537; Interrogation_Position=2674; Antisense; GGTCTTAAGTCTAAATATTGCCTAT
>probe:Drosophila_2:1631378_at:546:325; Interrogation_Position=2748; Antisense; GCGAAACACAAAGGTCGAGACATGT

Paste this into a BLAST search page for me
AACCAGATACGCGATATACAAGCAAATACAAGCAAAACGCCAGTTCATCAGCCAGTTCATCATAAATGCAACGATGATATCTATTTGTTTGACTTTCCTAGACTTTCCTAGGATGGAGATGGTCAGAGATGGTCAGGAGGTTAACGCTTTGGTTAACGCTTTTGACAGCTTTCAAGATTTCTTGTATTTCTCATAATGCTATTTAATTCCAAAACCTCTCCAGAGCCTCTCCAGAGATAATTTCCCAAAGAAAATTATAACATATTGCGCCTAAATGCGCCTAAATGTATTTGCCCCAAAGGTCTTAAGTCTAAATATTGCCTATGCGAAACACAAAGGTCGAGACATGT

Full Affymetrix probeset data:

Annotations for 1631378_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720