Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631381_at:

>probe:Drosophila_2:1631381_at:74:483; Interrogation_Position=1755; Antisense; GTATTATCATTTCCCACTTCGATGC
>probe:Drosophila_2:1631381_at:372:623; Interrogation_Position=1777; Antisense; TGCGGAGCGCGATGAAAACTTGTTC
>probe:Drosophila_2:1631381_at:559:603; Interrogation_Position=1797; Antisense; TGTTCGAAGTCGTAGCAGATGCCTC
>probe:Drosophila_2:1631381_at:653:97; Interrogation_Position=1813; Antisense; AGATGCCTCACAGCTGAAGCCAAAG
>probe:Drosophila_2:1631381_at:203:39; Interrogation_Position=1885; Antisense; ATCGGCTAAGAAGCGTTCTACCAAC
>probe:Drosophila_2:1631381_at:52:403; Interrogation_Position=1919; Antisense; GACTCAAAGGACGATGGACCCTCCA
>probe:Drosophila_2:1631381_at:69:353; Interrogation_Position=1953; Antisense; GCAGCCGGCCCAACGAAGTGGTTGA
>probe:Drosophila_2:1631381_at:439:209; Interrogation_Position=2022; Antisense; AAGCAGATGTTGTTGTCGTGGCCAC
>probe:Drosophila_2:1631381_at:135:299; Interrogation_Position=2158; Antisense; CGCGGGACCAACCAAGTGCAAACGT
>probe:Drosophila_2:1631381_at:50:587; Interrogation_Position=2190; Antisense; TGGACGATTCGAACCCCGTGGCAGT
>probe:Drosophila_2:1631381_at:474:301; Interrogation_Position=2204; Antisense; CCCGTGGCAGTCATCAGTATCGATT
>probe:Drosophila_2:1631381_at:29:367; Interrogation_Position=2253; Antisense; GAATAAGTTCTCAACTGCGCACTAA
>probe:Drosophila_2:1631381_at:559:163; Interrogation_Position=2276; Antisense; AAATTATGCTCTTGATTCCCTGTAA
>probe:Drosophila_2:1631381_at:690:463; Interrogation_Position=2289; Antisense; GATTCCCTGTAATTTCATTCTGATT

Paste this into a BLAST search page for me
GTATTATCATTTCCCACTTCGATGCTGCGGAGCGCGATGAAAACTTGTTCTGTTCGAAGTCGTAGCAGATGCCTCAGATGCCTCACAGCTGAAGCCAAAGATCGGCTAAGAAGCGTTCTACCAACGACTCAAAGGACGATGGACCCTCCAGCAGCCGGCCCAACGAAGTGGTTGAAAGCAGATGTTGTTGTCGTGGCCACCGCGGGACCAACCAAGTGCAAACGTTGGACGATTCGAACCCCGTGGCAGTCCCGTGGCAGTCATCAGTATCGATTGAATAAGTTCTCAACTGCGCACTAAAAATTATGCTCTTGATTCCCTGTAAGATTCCCTGTAATTTCATTCTGATT

Full Affymetrix probeset data:

Annotations for 1631381_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime