FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631382_at:

>probe:Drosophila_2:1631382_at:483:609; Interrogation_Position=1009; Antisense; TGAGCTTCCTCGTCAGTGACCTAAT
>probe:Drosophila_2:1631382_at:558:701; Interrogation_Position=1043; Antisense; TTTTAAGATATATGGCCCGCCTGCC
>probe:Drosophila_2:1631382_at:281:231; Interrogation_Position=1095; Antisense; AATGAGTACTTCAAGACCGCCTGAG
>probe:Drosophila_2:1631382_at:116:413; Interrogation_Position=1109; Antisense; GACCGCCTGAGTACATGTGGCACAG
>probe:Drosophila_2:1631382_at:303:463; Interrogation_Position=698; Antisense; GATTCGGGCTCTGAAGTTGGACCAT
>probe:Drosophila_2:1631382_at:455:79; Interrogation_Position=760; Antisense; AGGTGGTTCCATCGCTGCTATTTCT
>probe:Drosophila_2:1631382_at:299:689; Interrogation_Position=778; Antisense; TATTTCTGGACATGCGTCACTGCGA
>probe:Drosophila_2:1631382_at:719:423; Interrogation_Position=808; Antisense; GAGACTACCAGATAGCACAGCTCTT
>probe:Drosophila_2:1631382_at:440:357; Interrogation_Position=822; Antisense; GCACAGCTCTTGCAATCGGCAGATA
>probe:Drosophila_2:1631382_at:46:659; Interrogation_Position=845; Antisense; TAAGCTAAAGGCACTCGCTCTACTC
>probe:Drosophila_2:1631382_at:22:105; Interrogation_Position=883; Antisense; AGACGGGTGATTCCTATCTGCAGCC
>probe:Drosophila_2:1631382_at:611:617; Interrogation_Position=901; Antisense; TGCAGCCGCAACTACTCAACAGATT
>probe:Drosophila_2:1631382_at:609:95; Interrogation_Position=921; Antisense; AGATTGCCATCGCTGAAGCTCATTC
>probe:Drosophila_2:1631382_at:247:659; Interrogation_Position=949; Antisense; TAACCACCTTGGGTTCCATGGGCTT

Paste this into a BLAST search page for me
TGAGCTTCCTCGTCAGTGACCTAATTTTTAAGATATATGGCCCGCCTGCCAATGAGTACTTCAAGACCGCCTGAGGACCGCCTGAGTACATGTGGCACAGGATTCGGGCTCTGAAGTTGGACCATAGGTGGTTCCATCGCTGCTATTTCTTATTTCTGGACATGCGTCACTGCGAGAGACTACCAGATAGCACAGCTCTTGCACAGCTCTTGCAATCGGCAGATATAAGCTAAAGGCACTCGCTCTACTCAGACGGGTGATTCCTATCTGCAGCCTGCAGCCGCAACTACTCAACAGATTAGATTGCCATCGCTGAAGCTCATTCTAACCACCTTGGGTTCCATGGGCTT

Full Affymetrix probeset data:

Annotations for 1631382_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720