FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631383_at:

>probe:Drosophila_2:1631383_at:154:247; Interrogation_Position=112; Antisense; AATTCTCTGCTGTTGCTAATTGGAA
>probe:Drosophila_2:1631383_at:582:539; Interrogation_Position=153; Antisense; GGTTTGCCTCTTTCTTTGGATTTAT
>probe:Drosophila_2:1631383_at:476:541; Interrogation_Position=170; Antisense; GGATTTATATAACGGTATTCACCAC
>probe:Drosophila_2:1631383_at:517:539; Interrogation_Position=183; Antisense; GGTATTCACCACTCTCATATCGAAT
>probe:Drosophila_2:1631383_at:447:25; Interrogation_Position=253; Antisense; ATAGTTCCATCATTGACTCTGGAGG
>probe:Drosophila_2:1631383_at:719:145; Interrogation_Position=268; Antisense; ACTCTGGAGGGCTATTTCACATTGA
>probe:Drosophila_2:1631383_at:360:457; Interrogation_Position=291; Antisense; GATAGTCGCATCTTTAATTTGTAAA
>probe:Drosophila_2:1631383_at:626:145; Interrogation_Position=341; Antisense; ACTCATACACCGAAATGCACACTTC
>probe:Drosophila_2:1631383_at:615:85; Interrogation_Position=377; Antisense; AGTGCAGTTCTATCGAGAATACCGA
>probe:Drosophila_2:1631383_at:515:513; Interrogation_Position=484; Antisense; GTGATATTGGCCACCCATTCAAATA
>probe:Drosophila_2:1631383_at:714:109; Interrogation_Position=49; Antisense; AGAATGTTGCTTTATCATACAAGTA
>probe:Drosophila_2:1631383_at:145:653; Interrogation_Position=72; Antisense; TAATCGTTTTTGCATGGGACTCGGA
>probe:Drosophila_2:1631383_at:226:527; Interrogation_Position=87; Antisense; GGGACTCGGATTGGTTACTGTTCTC
>probe:Drosophila_2:1631383_at:677:589; Interrogation_Position=98; Antisense; TGGTTACTGTTCTCAATTCTCTGCT

Paste this into a BLAST search page for me
AATTCTCTGCTGTTGCTAATTGGAAGGTTTGCCTCTTTCTTTGGATTTATGGATTTATATAACGGTATTCACCACGGTATTCACCACTCTCATATCGAATATAGTTCCATCATTGACTCTGGAGGACTCTGGAGGGCTATTTCACATTGAGATAGTCGCATCTTTAATTTGTAAAACTCATACACCGAAATGCACACTTCAGTGCAGTTCTATCGAGAATACCGAGTGATATTGGCCACCCATTCAAATAAGAATGTTGCTTTATCATACAAGTATAATCGTTTTTGCATGGGACTCGGAGGGACTCGGATTGGTTACTGTTCTCTGGTTACTGTTCTCAATTCTCTGCT

Full Affymetrix probeset data:

Annotations for 1631383_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720