FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631384_at:

>probe:Drosophila_2:1631384_at:378:607; Interrogation_Position=272; Antisense; TGATGAGTGCCGATTGCTCCTCCAA
>probe:Drosophila_2:1631384_at:720:203; Interrogation_Position=340; Antisense; AAGCCTCGCATTAACTATGCTTCGG
>probe:Drosophila_2:1631384_at:616:371; Interrogation_Position=393; Antisense; GAAGGCACACTCTATTGATGGTACC
>probe:Drosophila_2:1631384_at:457:715; Interrogation_Position=434; Antisense; TTCTGGGTCTGGACTTCAGCACTAA
>probe:Drosophila_2:1631384_at:168:679; Interrogation_Position=471; Antisense; TATGATTCGAACTGGGCTTTCTCCG
>probe:Drosophila_2:1631384_at:494:279; Interrogation_Position=491; Antisense; CTCCGGGTTCATGCTTCGGATTTAA
>probe:Drosophila_2:1631384_at:330:143; Interrogation_Position=529; Antisense; ACTGTGACTCTTCATCTGGCCAGGA
>probe:Drosophila_2:1631384_at:213:75; Interrogation_Position=550; Antisense; AGGACCATCATCGTGGAGGCCATAA
>probe:Drosophila_2:1631384_at:633:167; Interrogation_Position=596; Antisense; AAATGACGCCCGATTTGTGCGTGAA
>probe:Drosophila_2:1631384_at:369:211; Interrogation_Position=619; Antisense; AAGAGTGCGCCCAAAAACTTCGATG
>probe:Drosophila_2:1631384_at:171:489; Interrogation_Position=713; Antisense; GTACTCAGAGCTACAGTGTGCGCAG
>probe:Drosophila_2:1631384_at:183:623; Interrogation_Position=731; Antisense; TGCGCAGCGACACCTTTTTTCGAAA
>probe:Drosophila_2:1631384_at:12:367; Interrogation_Position=777; Antisense; GAATCACGGTGCGAATTCCACTTGT
>probe:Drosophila_2:1631384_at:487:9; Interrogation_Position=791; Antisense; ATTCCACTTGTATTTATCGCGTTGA

Paste this into a BLAST search page for me
TGATGAGTGCCGATTGCTCCTCCAAAAGCCTCGCATTAACTATGCTTCGGGAAGGCACACTCTATTGATGGTACCTTCTGGGTCTGGACTTCAGCACTAATATGATTCGAACTGGGCTTTCTCCGCTCCGGGTTCATGCTTCGGATTTAAACTGTGACTCTTCATCTGGCCAGGAAGGACCATCATCGTGGAGGCCATAAAAATGACGCCCGATTTGTGCGTGAAAAGAGTGCGCCCAAAAACTTCGATGGTACTCAGAGCTACAGTGTGCGCAGTGCGCAGCGACACCTTTTTTCGAAAGAATCACGGTGCGAATTCCACTTGTATTCCACTTGTATTTATCGCGTTGA

Full Affymetrix probeset data:

Annotations for 1631384_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720