Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631385_at:

>probe:Drosophila_2:1631385_at:519:183; Interrogation_Position=1587; Antisense; AAAAGCTTTGCCAATGTACACCGCC
>probe:Drosophila_2:1631385_at:88:137; Interrogation_Position=1636; Antisense; ACGAAGACCTGCATCGTCACGTTTG
>probe:Drosophila_2:1631385_at:515:495; Interrogation_Position=1651; Antisense; GTCACGTTTGCGACATTTGCGGGAA
>probe:Drosophila_2:1631385_at:64:309; Interrogation_Position=1753; Antisense; CCATCTGCCGTGTTTGGCTGAAGAA
>probe:Drosophila_2:1631385_at:542:373; Interrogation_Position=1772; Antisense; GAAGAACGAGCACAGCTTGCGCCTG
>probe:Drosophila_2:1631385_at:631:131; Interrogation_Position=1824; Antisense; ACCGTGTGTCCGCATTGTGGCAAGA
>probe:Drosophila_2:1631385_at:568:537; Interrogation_Position=1875; Antisense; GGTCACGTCAAATATGCCCACAAGC
>probe:Drosophila_2:1631385_at:516:237; Interrogation_Position=1908; Antisense; AATCTGCAGTGCACGTTCTGCGAGA
>probe:Drosophila_2:1631385_at:539:423; Interrogation_Position=1929; Antisense; GAGAAAACCTTCAAGCAGCAGCGCA
>probe:Drosophila_2:1631385_at:439:113; Interrogation_Position=1945; Antisense; AGCAGCGCAACCTGGACGAGCACAT
>probe:Drosophila_2:1631385_at:598:617; Interrogation_Position=1987; Antisense; TGCAGCTGTACAACTGTCCGCATTG
>probe:Drosophila_2:1631385_at:154:471; Interrogation_Position=2026; Antisense; GTTCCCGCTCCAATATGTATGTCCA
>probe:Drosophila_2:1631385_at:175:485; Interrogation_Position=2042; Antisense; GTATGTCCACATTAAGCAGCGTCAC
>probe:Drosophila_2:1631385_at:218:173; Interrogation_Position=2134; Antisense; AAACCTGACCCCTCACAATTGTGTT

Paste this into a BLAST search page for me
AAAAGCTTTGCCAATGTACACCGCCACGAAGACCTGCATCGTCACGTTTGGTCACGTTTGCGACATTTGCGGGAACCATCTGCCGTGTTTGGCTGAAGAAGAAGAACGAGCACAGCTTGCGCCTGACCGTGTGTCCGCATTGTGGCAAGAGGTCACGTCAAATATGCCCACAAGCAATCTGCAGTGCACGTTCTGCGAGAGAGAAAACCTTCAAGCAGCAGCGCAAGCAGCGCAACCTGGACGAGCACATTGCAGCTGTACAACTGTCCGCATTGGTTCCCGCTCCAATATGTATGTCCAGTATGTCCACATTAAGCAGCGTCACAAACCTGACCCCTCACAATTGTGTT

Full Affymetrix probeset data:

Annotations for 1631385_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime