FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631387_at:

>probe:Drosophila_2:1631387_at:379:57; Interrogation_Position=1584; Antisense; ATGATGCGTGGCGTCATGGGACCTA
>probe:Drosophila_2:1631387_at:261:65; Interrogation_Position=1599; Antisense; ATGGGACCTATGTGCCGCGCGATTC
>probe:Drosophila_2:1631387_at:76:355; Interrogation_Position=1635; Antisense; GCACCCGCGACTGAAGTTGGCAAGA
>probe:Drosophila_2:1631387_at:48:467; Interrogation_Position=1650; Antisense; GTTGGCAAGATCTTTGCTCTGACCA
>probe:Drosophila_2:1631387_at:37:67; Interrogation_Position=1680; Antisense; ATGGAATCGGTTTCGCCACTGGGCG
>probe:Drosophila_2:1631387_at:353:491; Interrogation_Position=1715; Antisense; GTACACAACCGTCTACAAGGCAACT
>probe:Drosophila_2:1631387_at:417:11; Interrogation_Position=1747; Antisense; ATTATCCCGGAGCTTTCAACTTTAT
>probe:Drosophila_2:1631387_at:675:319; Interrogation_Position=1776; Antisense; GCCGCTCTCTACTTTGTGTGTTACA
>probe:Drosophila_2:1631387_at:334:517; Interrogation_Position=1791; Antisense; GTGTGTTACATTCTGATAGCCGTGA
>probe:Drosophila_2:1631387_at:569:27; Interrogation_Position=1806; Antisense; ATAGCCGTGATCTTCGGCATCCAGA
>probe:Drosophila_2:1631387_at:728:677; Interrogation_Position=1841; Antisense; TAGTAGCAGTGTCTACCAGGCCATT
>probe:Drosophila_2:1631387_at:114:179; Interrogation_Position=1876; Antisense; AAACTCTCCAGAGCACCGATTTAGC
>probe:Drosophila_2:1631387_at:399:657; Interrogation_Position=1914; Antisense; TAAGTTAAATTCCTTCTGCAGGCGC
>probe:Drosophila_2:1631387_at:715:323; Interrogation_Position=1935; Antisense; GCGCTGCGAAGAGCTCTCGTTTTAA

Paste this into a BLAST search page for me
ATGATGCGTGGCGTCATGGGACCTAATGGGACCTATGTGCCGCGCGATTCGCACCCGCGACTGAAGTTGGCAAGAGTTGGCAAGATCTTTGCTCTGACCAATGGAATCGGTTTCGCCACTGGGCGGTACACAACCGTCTACAAGGCAACTATTATCCCGGAGCTTTCAACTTTATGCCGCTCTCTACTTTGTGTGTTACAGTGTGTTACATTCTGATAGCCGTGAATAGCCGTGATCTTCGGCATCCAGATAGTAGCAGTGTCTACCAGGCCATTAAACTCTCCAGAGCACCGATTTAGCTAAGTTAAATTCCTTCTGCAGGCGCGCGCTGCGAAGAGCTCTCGTTTTAA

Full Affymetrix probeset data:

Annotations for 1631387_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720