FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631388_at:

>probe:Drosophila_2:1631388_at:718:673; Interrogation_Position=1332; Antisense; TAGCCATTTTCACTAGCCAACTCTT
>probe:Drosophila_2:1631388_at:160:675; Interrogation_Position=1345; Antisense; TAGCCAACTCTTCGATCAATCAGAC
>probe:Drosophila_2:1631388_at:44:647; Interrogation_Position=1388; Antisense; TCATACTTCACAATTGCTGCCCAGT
>probe:Drosophila_2:1631388_at:692:335; Interrogation_Position=1403; Antisense; GCTGCCCAGTCTAGTAAAAGTCCCG
>probe:Drosophila_2:1631388_at:246:183; Interrogation_Position=1418; Antisense; AAAAGTCCCGCTGCCGAGCATATTT
>probe:Drosophila_2:1631388_at:433:419; Interrogation_Position=1433; Antisense; GAGCATATTTACTACACCGATCCAC
>probe:Drosophila_2:1631388_at:98:131; Interrogation_Position=1456; Antisense; ACCTACCTACGAGCTGGATTATGAC
>probe:Drosophila_2:1631388_at:670:7; Interrogation_Position=1487; Antisense; ATTGCCAATGCTCGCGACATATTTG
>probe:Drosophila_2:1631388_at:265:167; Interrogation_Position=1515; Antisense; AAATGTTCCCAGATGCCGACTTTTT
>probe:Drosophila_2:1631388_at:346:509; Interrogation_Position=1578; Antisense; GTGAAGACCCTAGTGCCTTGAACGA
>probe:Drosophila_2:1631388_at:210:383; Interrogation_Position=1597; Antisense; GAACGAGCACACTTTGCCCGAAGAT
>probe:Drosophila_2:1631388_at:40:461; Interrogation_Position=1619; Antisense; GATTTGCGGGCACAATTGCACGACA
>probe:Drosophila_2:1631388_at:467:75; Interrogation_Position=1698; Antisense; AGGAGGTTTCCTTGGTCTACATATA
>probe:Drosophila_2:1631388_at:90:513; Interrogation_Position=1868; Antisense; GTGAGTGTTTCTGTGCATTTTGCTT

Paste this into a BLAST search page for me
TAGCCATTTTCACTAGCCAACTCTTTAGCCAACTCTTCGATCAATCAGACTCATACTTCACAATTGCTGCCCAGTGCTGCCCAGTCTAGTAAAAGTCCCGAAAAGTCCCGCTGCCGAGCATATTTGAGCATATTTACTACACCGATCCACACCTACCTACGAGCTGGATTATGACATTGCCAATGCTCGCGACATATTTGAAATGTTCCCAGATGCCGACTTTTTGTGAAGACCCTAGTGCCTTGAACGAGAACGAGCACACTTTGCCCGAAGATGATTTGCGGGCACAATTGCACGACAAGGAGGTTTCCTTGGTCTACATATAGTGAGTGTTTCTGTGCATTTTGCTT

Full Affymetrix probeset data:

Annotations for 1631388_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720