FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631390_at:

>probe:Drosophila_2:1631390_at:211:303; Interrogation_Position=1005; Antisense; CCGCGGGTCGATCAGTTCAGTACAA
>probe:Drosophila_2:1631390_at:182:455; Interrogation_Position=1157; Antisense; GATCACATTACGTTTCCCATAATCA
>probe:Drosophila_2:1631390_at:505:427; Interrogation_Position=629; Antisense; GAGATAGACTACATCCTGTTCCTGC
>probe:Drosophila_2:1631390_at:608:463; Interrogation_Position=646; Antisense; GTTCCTGCAAAAAGACGTGACGCTG
>probe:Drosophila_2:1631390_at:41:513; Interrogation_Position=662; Antisense; GTGACGCTGCGTCCAAATAGCAACG
>probe:Drosophila_2:1631390_at:44:139; Interrogation_Position=684; Antisense; ACGAGGTCAGTGAGGTGCGCTACTT
>probe:Drosophila_2:1631390_at:342:149; Interrogation_Position=705; Antisense; ACTTGCGCCGCGATAAGATCGACGA
>probe:Drosophila_2:1631390_at:274:521; Interrogation_Position=734; Antisense; GTGGCGAAGTTTAGTGCCCCGCTGA
>probe:Drosophila_2:1631390_at:264:469; Interrogation_Position=766; Antisense; GTTCTCTCTGATTCTGCAGCATCGA
>probe:Drosophila_2:1631390_at:223:345; Interrogation_Position=784; Antisense; GCATCGATTGAAACTCTGGTGGGAC
>probe:Drosophila_2:1631390_at:235:397; Interrogation_Position=806; Antisense; GACAATTTGCACCAGCTGGAGCAAT
>probe:Drosophila_2:1631390_at:605:321; Interrogation_Position=853; Antisense; GCGCTTTTAAGTGTGCTAACCAACC
>probe:Drosophila_2:1631390_at:649:591; Interrogation_Position=920; Antisense; TGGGTTTCAAATTCGCTTTATTCAA
>probe:Drosophila_2:1631390_at:419:543; Interrogation_Position=989; Antisense; GGATTTTATGCAACCTCCGCGGGTC

Paste this into a BLAST search page for me
CCGCGGGTCGATCAGTTCAGTACAAGATCACATTACGTTTCCCATAATCAGAGATAGACTACATCCTGTTCCTGCGTTCCTGCAAAAAGACGTGACGCTGGTGACGCTGCGTCCAAATAGCAACGACGAGGTCAGTGAGGTGCGCTACTTACTTGCGCCGCGATAAGATCGACGAGTGGCGAAGTTTAGTGCCCCGCTGAGTTCTCTCTGATTCTGCAGCATCGAGCATCGATTGAAACTCTGGTGGGACGACAATTTGCACCAGCTGGAGCAATGCGCTTTTAAGTGTGCTAACCAACCTGGGTTTCAAATTCGCTTTATTCAAGGATTTTATGCAACCTCCGCGGGTC

Full Affymetrix probeset data:

Annotations for 1631390_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720