FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631392_at:

>probe:Drosophila_2:1631392_at:633:663; Interrogation_Position=1700; Antisense; TAAAGCAGCTGAGTGGCGTGGCCTT
>probe:Drosophila_2:1631392_at:439:645; Interrogation_Position=1739; Antisense; TCTTCCCCTTCCGTGATAATATCGA
>probe:Drosophila_2:1631392_at:70:453; Interrogation_Position=1753; Antisense; GATAATATCGATCGCGCTAGCCTGA
>probe:Drosophila_2:1631392_at:157:609; Interrogation_Position=1775; Antisense; TGAGCGGCGTCTCCTACATAGCCAG
>probe:Drosophila_2:1631392_at:401:57; Interrogation_Position=1817; Antisense; ATGATGCTGGTGTCATTGCCGCCTG
>probe:Drosophila_2:1631392_at:262:113; Interrogation_Position=1847; Antisense; AGCACGGTATCATCATGGCCCATAC
>probe:Drosophila_2:1631392_at:385:69; Interrogation_Position=1861; Antisense; ATGGCCCATACCAATCTGCGATTGT
>probe:Drosophila_2:1631392_at:639:281; Interrogation_Position=1876; Antisense; CTGCGATTGTTCCACCATTAGGTTC
>probe:Drosophila_2:1631392_at:97:15; Interrogation_Position=1892; Antisense; ATTAGGTTCAACACACTCTTGAGTA
>probe:Drosophila_2:1631392_at:47:27; Interrogation_Position=1916; Antisense; ATACGATTCATTCCCAGTTTTTAAG
>probe:Drosophila_2:1631392_at:399:207; Interrogation_Position=1938; Antisense; AAGCTCTTTCTTTGATTTCCATAAA
>probe:Drosophila_2:1631392_at:669:663; Interrogation_Position=1972; Antisense; TAAATCCCAACTTCTCAAGTCGAAT
>probe:Drosophila_2:1631392_at:161:655; Interrogation_Position=2188; Antisense; TAATCAAACCCCATCAAACTGCCTT
>probe:Drosophila_2:1631392_at:87:179; Interrogation_Position=2203; Antisense; AAACTGCCTTATGACCATTCCAAGC

Paste this into a BLAST search page for me
TAAAGCAGCTGAGTGGCGTGGCCTTTCTTCCCCTTCCGTGATAATATCGAGATAATATCGATCGCGCTAGCCTGATGAGCGGCGTCTCCTACATAGCCAGATGATGCTGGTGTCATTGCCGCCTGAGCACGGTATCATCATGGCCCATACATGGCCCATACCAATCTGCGATTGTCTGCGATTGTTCCACCATTAGGTTCATTAGGTTCAACACACTCTTGAGTAATACGATTCATTCCCAGTTTTTAAGAAGCTCTTTCTTTGATTTCCATAAATAAATCCCAACTTCTCAAGTCGAATTAATCAAACCCCATCAAACTGCCTTAAACTGCCTTATGACCATTCCAAGC

Full Affymetrix probeset data:

Annotations for 1631392_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720