FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631393_at:

>probe:Drosophila_2:1631393_at:561:41; Interrogation_Position=1029; Antisense; ATCGGACGACGCCTAAATCAGATGG
>probe:Drosophila_2:1631393_at:517:585; Interrogation_Position=1051; Antisense; TGGAAGTGGAATTTCGCAGGGCCAA
>probe:Drosophila_2:1631393_at:580:47; Interrogation_Position=1141; Antisense; ATCCTGATTGTGGAGCTTGATTAAT
>probe:Drosophila_2:1631393_at:28:439; Interrogation_Position=1199; Antisense; GATAGGGCTAACAACTTTTCGGAGT
>probe:Drosophila_2:1631393_at:98:145; Interrogation_Position=1289; Antisense; ACTTTTCCGACCCAATAAGCATTTG
>probe:Drosophila_2:1631393_at:305:323; Interrogation_Position=811; Antisense; GCGCTGTCAGCGTTTTAGAACCATC
>probe:Drosophila_2:1631393_at:500:127; Interrogation_Position=830; Antisense; ACCATCAGACATCAGCGGACCGAAG
>probe:Drosophila_2:1631393_at:227:33; Interrogation_Position=840; Antisense; ATCAGCGGACCGAAGGAAGACCTCA
>probe:Drosophila_2:1631393_at:356:213; Interrogation_Position=856; Antisense; AAGACCTCAGCAGTCGGGCCCAGTA
>probe:Drosophila_2:1631393_at:197:233; Interrogation_Position=907; Antisense; AATGCAAAATGCTTACCCTGGACCA
>probe:Drosophila_2:1631393_at:188:587; Interrogation_Position=925; Antisense; TGGACCACTCCGTTGATATCTTTAG
>probe:Drosophila_2:1631393_at:283:459; Interrogation_Position=939; Antisense; GATATCTTTAGCGACAAGTTCCATC
>probe:Drosophila_2:1631393_at:637:215; Interrogation_Position=954; Antisense; AAGTTCCATCGTAGTCTGGTCACTA
>probe:Drosophila_2:1631393_at:517:229; Interrogation_Position=998; Antisense; AATGGTGTCGATTGCACTGGTGCGC

Paste this into a BLAST search page for me
ATCGGACGACGCCTAAATCAGATGGTGGAAGTGGAATTTCGCAGGGCCAAATCCTGATTGTGGAGCTTGATTAATGATAGGGCTAACAACTTTTCGGAGTACTTTTCCGACCCAATAAGCATTTGGCGCTGTCAGCGTTTTAGAACCATCACCATCAGACATCAGCGGACCGAAGATCAGCGGACCGAAGGAAGACCTCAAAGACCTCAGCAGTCGGGCCCAGTAAATGCAAAATGCTTACCCTGGACCATGGACCACTCCGTTGATATCTTTAGGATATCTTTAGCGACAAGTTCCATCAAGTTCCATCGTAGTCTGGTCACTAAATGGTGTCGATTGCACTGGTGCGC

Full Affymetrix probeset data:

Annotations for 1631393_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720