FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631394_at:

>probe:Drosophila_2:1631394_at:249:49; Interrogation_Position=1326; Antisense; ATCCAAATTTCAATGGGCTTCGTTT
>probe:Drosophila_2:1631394_at:628:335; Interrogation_Position=1342; Antisense; GCTTCGTTTTGAAAAATTCGTACTG
>probe:Drosophila_2:1631394_at:52:395; Interrogation_Position=1404; Antisense; GAAATCGCTATGCTAACATTTACAA
>probe:Drosophila_2:1631394_at:138:505; Interrogation_Position=1461; Antisense; GTCCAAAAGTGTATCTGTAGTCGTT
>probe:Drosophila_2:1631394_at:78:59; Interrogation_Position=1496; Antisense; ATGTTTTACAGTCTCTACACTCAAG
>probe:Drosophila_2:1631394_at:170:687; Interrogation_Position=1551; Antisense; TATATCTAGATAACCCCAGCATAAT
>probe:Drosophila_2:1631394_at:348:31; Interrogation_Position=1574; Antisense; ATCAATGGAACCCTACTACGCTTTT
>probe:Drosophila_2:1631394_at:400:665; Interrogation_Position=1587; Antisense; TACTACGCTTTTCGCTTTATACAAC
>probe:Drosophila_2:1631394_at:718:363; Interrogation_Position=1713; Antisense; GAATATGCCTAAGTATATCGAAACT
>probe:Drosophila_2:1631394_at:470:389; Interrogation_Position=1732; Antisense; GAAACTATCAAAACGCTACAAAGCA
>probe:Drosophila_2:1631394_at:713:357; Interrogation_Position=1793; Antisense; GCAAATCTTTCCAATTCTAAATCTT
>probe:Drosophila_2:1631394_at:721:239; Interrogation_Position=1820; Antisense; AATAAACCTCTCTGGCATATTCCTC
>probe:Drosophila_2:1631394_at:346:583; Interrogation_Position=1832; Antisense; TGGCATATTCCTCCTACCTAAAGGA
>probe:Drosophila_2:1631394_at:250:387; Interrogation_Position=1855; Antisense; GAACAAATCATCCAACTCATAACAA

Paste this into a BLAST search page for me
ATCCAAATTTCAATGGGCTTCGTTTGCTTCGTTTTGAAAAATTCGTACTGGAAATCGCTATGCTAACATTTACAAGTCCAAAAGTGTATCTGTAGTCGTTATGTTTTACAGTCTCTACACTCAAGTATATCTAGATAACCCCAGCATAATATCAATGGAACCCTACTACGCTTTTTACTACGCTTTTCGCTTTATACAACGAATATGCCTAAGTATATCGAAACTGAAACTATCAAAACGCTACAAAGCAGCAAATCTTTCCAATTCTAAATCTTAATAAACCTCTCTGGCATATTCCTCTGGCATATTCCTCCTACCTAAAGGAGAACAAATCATCCAACTCATAACAA

Full Affymetrix probeset data:

Annotations for 1631394_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720