FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631396_at:

>probe:Drosophila_2:1631396_at:30:97; Interrogation_Position=1955; Antisense; AGATACAGATACCACAGCCTCTTCT
>probe:Drosophila_2:1631396_at:680:261; Interrogation_Position=1969; Antisense; CAGCCTCTTCTCTTTTGGAATCACA
>probe:Drosophila_2:1631396_at:93:631; Interrogation_Position=2006; Antisense; TCCTTCGCCTTTAGAATCCCAAGAA
>probe:Drosophila_2:1631396_at:240:495; Interrogation_Position=2099; Antisense; GTCACTGGATTTACTTCTGGAAAAC
>probe:Drosophila_2:1631396_at:133:563; Interrogation_Position=2129; Antisense; GGAACCCACTCAGGAATCCGACAGG
>probe:Drosophila_2:1631396_at:184:59; Interrogation_Position=2161; Antisense; ATGATGCCATCATTCTGCTATCGGA
>probe:Drosophila_2:1631396_at:470:39; Interrogation_Position=2180; Antisense; ATCGGACGACAGCTGTAGCTCGGAT
>probe:Drosophila_2:1631396_at:354:545; Interrogation_Position=2201; Antisense; GGATCAGAGAGCATCATCTACCTCA
>probe:Drosophila_2:1631396_at:151:201; Interrogation_Position=2239; Antisense; AACGCCAGAACTTTTTGCCAACCAG
>probe:Drosophila_2:1631396_at:23:431; Interrogation_Position=2282; Antisense; GAGTAAACCCTCCACTGCCAAGAAG
>probe:Drosophila_2:1631396_at:350:313; Interrogation_Position=2350; Antisense; GCCAGAATCAAACCAAGCTCAGCAT
>probe:Drosophila_2:1631396_at:86:115; Interrogation_Position=2370; Antisense; AGCATGTTTGGCTTCCAGACGAAAC
>probe:Drosophila_2:1631396_at:295:305; Interrogation_Position=2394; Antisense; CCTGTCCTCAAATAGATGGCTCTTC
>probe:Drosophila_2:1631396_at:144:441; Interrogation_Position=2408; Antisense; GATGGCTCTTCTAGATTGTAAGCTT

Paste this into a BLAST search page for me
AGATACAGATACCACAGCCTCTTCTCAGCCTCTTCTCTTTTGGAATCACATCCTTCGCCTTTAGAATCCCAAGAAGTCACTGGATTTACTTCTGGAAAACGGAACCCACTCAGGAATCCGACAGGATGATGCCATCATTCTGCTATCGGAATCGGACGACAGCTGTAGCTCGGATGGATCAGAGAGCATCATCTACCTCAAACGCCAGAACTTTTTGCCAACCAGGAGTAAACCCTCCACTGCCAAGAAGGCCAGAATCAAACCAAGCTCAGCATAGCATGTTTGGCTTCCAGACGAAACCCTGTCCTCAAATAGATGGCTCTTCGATGGCTCTTCTAGATTGTAAGCTT

Full Affymetrix probeset data:

Annotations for 1631396_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720