Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631398_at:

>probe:Drosophila_2:1631398_at:292:335; Interrogation_Position=2811; Antisense; GCTGATCATCGCCTTGTCAATTAAC
>probe:Drosophila_2:1631398_at:119:711; Interrogation_Position=2831; Antisense; TTAACGTCTTTATCTGCTTCAGGCA
>probe:Drosophila_2:1631398_at:123:387; Interrogation_Position=2878; Antisense; GAACACGAAATATGCCTCAGCTTGG
>probe:Drosophila_2:1631398_at:143:29; Interrogation_Position=2934; Antisense; ATACGATGCATTCCTATCATTCACC
>probe:Drosophila_2:1631398_at:357:381; Interrogation_Position=3003; Antisense; GAACGGCAGGCACAAGTTTAGGCTA
>probe:Drosophila_2:1631398_at:32:479; Interrogation_Position=3018; Antisense; GTTTAGGCTATGCTTCTACCTGCGA
>probe:Drosophila_2:1631398_at:477:87; Interrogation_Position=3059; Antisense; AGTCCATTCCCGATTGCATTAACCA
>probe:Drosophila_2:1631398_at:190:203; Interrogation_Position=3079; Antisense; AACCAATCTGTCAAGGGCTCAAGGC
>probe:Drosophila_2:1631398_at:644:571; Interrogation_Position=3094; Antisense; GGCTCAAGGCGCATTATCATCCTGA
>probe:Drosophila_2:1631398_at:173:105; Interrogation_Position=3163; Antisense; AGACTGGCGCTGCATGCAACATCGA
>probe:Drosophila_2:1631398_at:592:461; Interrogation_Position=3203; Antisense; GATTGATCGTTGTCCTTTATCCTGA
>probe:Drosophila_2:1631398_at:587:515; Interrogation_Position=3263; Antisense; GGGCGTACATGGTGCTTAATACCTA
>probe:Drosophila_2:1631398_at:358:339; Interrogation_Position=3321; Antisense; GCTAATGTATTCGATGCCGCATGCC
>probe:Drosophila_2:1631398_at:669:625; Interrogation_Position=3335; Antisense; TGCCGCATGCCAGCCATTTGAAGAG

Paste this into a BLAST search page for me
GCTGATCATCGCCTTGTCAATTAACTTAACGTCTTTATCTGCTTCAGGCAGAACACGAAATATGCCTCAGCTTGGATACGATGCATTCCTATCATTCACCGAACGGCAGGCACAAGTTTAGGCTAGTTTAGGCTATGCTTCTACCTGCGAAGTCCATTCCCGATTGCATTAACCAAACCAATCTGTCAAGGGCTCAAGGCGGCTCAAGGCGCATTATCATCCTGAAGACTGGCGCTGCATGCAACATCGAGATTGATCGTTGTCCTTTATCCTGAGGGCGTACATGGTGCTTAATACCTAGCTAATGTATTCGATGCCGCATGCCTGCCGCATGCCAGCCATTTGAAGAG

Full Affymetrix probeset data:

Annotations for 1631398_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime