FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631400_at:

>probe:Drosophila_2:1631400_at:503:271; Interrogation_Position=1032; Antisense; CATTCATTTAGGTTCGACTTTCTTG
>probe:Drosophila_2:1631400_at:633:399; Interrogation_Position=499; Antisense; GACAGCACAAGTTGTCGCTGCAGCA
>probe:Drosophila_2:1631400_at:644:191; Interrogation_Position=555; Antisense; AACTCCTCGTACCAGTTTGGATTCG
>probe:Drosophila_2:1631400_at:57:429; Interrogation_Position=594; Antisense; GAGTTTACCAACTACCAGAACCGCA
>probe:Drosophila_2:1631400_at:489:95; Interrogation_Position=622; Antisense; AGATTCGCGACGGTTCGGTGATCAA
>probe:Drosophila_2:1631400_at:95:519; Interrogation_Position=660; Antisense; GTGGTGGACTCCGATGGCTTCATCC
>probe:Drosophila_2:1631400_at:334:651; Interrogation_Position=691; Antisense; TCAAGTACACGGCTGATCCAAAGGA
>probe:Drosophila_2:1631400_at:319:461; Interrogation_Position=718; Antisense; GATTCAAGGCCGAGGTCATTCGCGA
>probe:Drosophila_2:1631400_at:138:417; Interrogation_Position=741; Antisense; GAGCCCACCGACATCGTGGTGAAGA
>probe:Drosophila_2:1631400_at:699:521; Interrogation_Position=837; Antisense; GGGCCCAGCAAGCAGCAGTATCAGC
>probe:Drosophila_2:1631400_at:515:483; Interrogation_Position=902; Antisense; GTAGGTGATTCGACCATCCAAGATC
>probe:Drosophila_2:1631400_at:90:55; Interrogation_Position=928; Antisense; ATGACTCTTGTCGAAACACTCTTGA
>probe:Drosophila_2:1631400_at:187:393; Interrogation_Position=951; Antisense; GAAAGTTCCGCAAGTCCATGTAGTT
>probe:Drosophila_2:1631400_at:542:23; Interrogation_Position=981; Antisense; ATATGCCGAGACTCGATTGGCACGA

Paste this into a BLAST search page for me
CATTCATTTAGGTTCGACTTTCTTGGACAGCACAAGTTGTCGCTGCAGCAAACTCCTCGTACCAGTTTGGATTCGGAGTTTACCAACTACCAGAACCGCAAGATTCGCGACGGTTCGGTGATCAAGTGGTGGACTCCGATGGCTTCATCCTCAAGTACACGGCTGATCCAAAGGAGATTCAAGGCCGAGGTCATTCGCGAGAGCCCACCGACATCGTGGTGAAGAGGGCCCAGCAAGCAGCAGTATCAGCGTAGGTGATTCGACCATCCAAGATCATGACTCTTGTCGAAACACTCTTGAGAAAGTTCCGCAAGTCCATGTAGTTATATGCCGAGACTCGATTGGCACGA

Full Affymetrix probeset data:

Annotations for 1631400_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720