FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631403_at:

>probe:Drosophila_2:1631403_at:655:41; Interrogation_Position=1019; Antisense; ATCGAGAAGGCCGAGCGTCCTGAGC
>probe:Drosophila_2:1631403_at:478:351; Interrogation_Position=1044; Antisense; GCAGAGAACTGCCTCCAGCCGTTAT
>probe:Drosophila_2:1631403_at:373:651; Interrogation_Position=1074; Antisense; TCACCCTGGCCTCCATGGATGAGTA
>probe:Drosophila_2:1631403_at:109:467; Interrogation_Position=1108; Antisense; GTTGCAGAACGGACTCAACTTCTAC
>probe:Drosophila_2:1631403_at:382:189; Interrogation_Position=1124; Antisense; AACTTCTACGATGCCACGTTCTTTC
>probe:Drosophila_2:1631403_at:567:141; Interrogation_Position=1151; Antisense; ACTGAGGCCAACATCTCGCTGAAGG
>probe:Drosophila_2:1631403_at:101:285; Interrogation_Position=1169; Antisense; CTGAAGGGCGCCAAGATCGATTATA
>probe:Drosophila_2:1631403_at:709:121; Interrogation_Position=1194; Antisense; AGCGCAGAATGCTCGATGGCTCGAT
>probe:Drosophila_2:1631403_at:472:701; Interrogation_Position=1248; Antisense; TTTTCGATGCGGCTGGCTTCTGCAA
>probe:Drosophila_2:1631403_at:626:711; Interrogation_Position=722; Antisense; TTCACCCTGTACGTGCTGGATGTGC
>probe:Drosophila_2:1631403_at:158:435; Interrogation_Position=764; Antisense; GAGGATATCCGGCATGCCATGTACA
>probe:Drosophila_2:1631403_at:137:625; Interrogation_Position=778; Antisense; TGCCATGTACAAGTTCGATTCGGTG
>probe:Drosophila_2:1631403_at:295:435; Interrogation_Position=806; Antisense; GAGGTGGTGCGCCTGCACATCTACT
>probe:Drosophila_2:1631403_at:619:197; Interrogation_Position=979; Antisense; AAGCGTCTCCAAGAGCGTGGGTTCT

Paste this into a BLAST search page for me
ATCGAGAAGGCCGAGCGTCCTGAGCGCAGAGAACTGCCTCCAGCCGTTATTCACCCTGGCCTCCATGGATGAGTAGTTGCAGAACGGACTCAACTTCTACAACTTCTACGATGCCACGTTCTTTCACTGAGGCCAACATCTCGCTGAAGGCTGAAGGGCGCCAAGATCGATTATAAGCGCAGAATGCTCGATGGCTCGATTTTTCGATGCGGCTGGCTTCTGCAATTCACCCTGTACGTGCTGGATGTGCGAGGATATCCGGCATGCCATGTACATGCCATGTACAAGTTCGATTCGGTGGAGGTGGTGCGCCTGCACATCTACTAAGCGTCTCCAAGAGCGTGGGTTCT

Full Affymetrix probeset data:

Annotations for 1631403_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720