Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631404_at:

>probe:Drosophila_2:1631404_at:712:511; Interrogation_Position=3254; Antisense; GTGACCGTGACGATGGTCCTCGCCG
>probe:Drosophila_2:1631404_at:24:631; Interrogation_Position=3270; Antisense; TCCTCGCCGGGATCGTGACGATGAG
>probe:Drosophila_2:1631404_at:613:295; Interrogation_Position=3333; Antisense; CGACGAGCCTCAGCGGGAAACTGGA
>probe:Drosophila_2:1631404_at:245:423; Interrogation_Position=3436; Antisense; GAGACTCGTGGCGATCAACGCGGCT
>probe:Drosophila_2:1631404_at:688:199; Interrogation_Position=3452; Antisense; AACGCGGCTCTGCTCCTAAGGAGGC
>probe:Drosophila_2:1631404_at:431:485; Interrogation_Position=3490; Antisense; GTAGGCGGAAACTGGCGTACTGCTC
>probe:Drosophila_2:1631404_at:223:145; Interrogation_Position=3508; Antisense; ACTGCTCCTGCGACCCGTGAGGAAA
>probe:Drosophila_2:1631404_at:701:117; Interrogation_Position=3540; Antisense; AGCTAAGCGCGATCAAGCCCAGGAA
>probe:Drosophila_2:1631404_at:368:517; Interrogation_Position=3594; Antisense; GTGGACCAGCGTTAAGCGTCGTTAA
>probe:Drosophila_2:1631404_at:284:697; Interrogation_Position=3626; Antisense; TTTCATCATCGTATATACCCAGCAT
>probe:Drosophila_2:1631404_at:81:643; Interrogation_Position=3674; Antisense; TCATCCGACTTGTACTTTATTGGTG
>probe:Drosophila_2:1631404_at:266:691; Interrogation_Position=3691; Antisense; TATTGGTGTAGAGCTCAGTCGGCCG
>probe:Drosophila_2:1631404_at:189:649; Interrogation_Position=3705; Antisense; TCAGTCGGCCGGTATATTATATCTA
>probe:Drosophila_2:1631404_at:151:279; Interrogation_Position=3727; Antisense; CTATCTATCCAAAGCTTGTGCCAGA

Paste this into a BLAST search page for me
GTGACCGTGACGATGGTCCTCGCCGTCCTCGCCGGGATCGTGACGATGAGCGACGAGCCTCAGCGGGAAACTGGAGAGACTCGTGGCGATCAACGCGGCTAACGCGGCTCTGCTCCTAAGGAGGCGTAGGCGGAAACTGGCGTACTGCTCACTGCTCCTGCGACCCGTGAGGAAAAGCTAAGCGCGATCAAGCCCAGGAAGTGGACCAGCGTTAAGCGTCGTTAATTTCATCATCGTATATACCCAGCATTCATCCGACTTGTACTTTATTGGTGTATTGGTGTAGAGCTCAGTCGGCCGTCAGTCGGCCGGTATATTATATCTACTATCTATCCAAAGCTTGTGCCAGA

Full Affymetrix probeset data:

Annotations for 1631404_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime