Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631405_at:

>probe:Drosophila_2:1631405_at:379:93; Interrogation_Position=1892; Antisense; AGTTCTTCTACTTGTCGGATCCTAA
>probe:Drosophila_2:1631405_at:621:409; Interrogation_Position=1934; Antisense; GACCCTACTACCTAATGCGACTAAA
>probe:Drosophila_2:1631405_at:473:597; Interrogation_Position=1968; Antisense; TGTGCCACACGGACTTCTACAGGAG
>probe:Drosophila_2:1631405_at:365:667; Interrogation_Position=1985; Antisense; TACAGGAGCCATTCTTTGCAGCGGA
>probe:Drosophila_2:1631405_at:161:725; Interrogation_Position=2000; Antisense; TTGCAGCGGATAGCCACGACATATT
>probe:Drosophila_2:1631405_at:542:153; Interrogation_Position=2030; Antisense; ACAGCCTGTTGGGATTCGTACTTGC
>probe:Drosophila_2:1631405_at:326:91; Interrogation_Position=2060; Antisense; AGTTGATGCACTCAGTCGACACCGT
>probe:Drosophila_2:1631405_at:232:151; Interrogation_Position=2216; Antisense; ACATTGCTGGACTGGATCTGGCCTA
>probe:Drosophila_2:1631405_at:46:643; Interrogation_Position=2274; Antisense; TCTAACCGATTTTACGACCATTCCG
>probe:Drosophila_2:1631405_at:431:255; Interrogation_Position=2302; Antisense; CAACAAATCTTCTTCCTCAATCTGG
>probe:Drosophila_2:1631405_at:671:713; Interrogation_Position=2332; Antisense; TTCTTCTGCGGCGATGGTGATCCAA
>probe:Drosophila_2:1631405_at:244:425; Interrogation_Position=2383; Antisense; GAGACGCGTCTGCAGCAAATGCTCA
>probe:Drosophila_2:1631405_at:209:255; Interrogation_Position=2398; Antisense; CAAATGCTCAATGGGTTCGCGCCGT
>probe:Drosophila_2:1631405_at:348:317; Interrogation_Position=2418; Antisense; GCCGTTTCACGAAGCTTTTGGTTGT

Paste this into a BLAST search page for me
AGTTCTTCTACTTGTCGGATCCTAAGACCCTACTACCTAATGCGACTAAATGTGCCACACGGACTTCTACAGGAGTACAGGAGCCATTCTTTGCAGCGGATTGCAGCGGATAGCCACGACATATTACAGCCTGTTGGGATTCGTACTTGCAGTTGATGCACTCAGTCGACACCGTACATTGCTGGACTGGATCTGGCCTATCTAACCGATTTTACGACCATTCCGCAACAAATCTTCTTCCTCAATCTGGTTCTTCTGCGGCGATGGTGATCCAAGAGACGCGTCTGCAGCAAATGCTCACAAATGCTCAATGGGTTCGCGCCGTGCCGTTTCACGAAGCTTTTGGTTGT

Full Affymetrix probeset data:

Annotations for 1631405_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime