FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631406_at:

>probe:Drosophila_2:1631406_at:630:203; Interrogation_Position=2553; Antisense; AAGCCTATTACGAGCACTGCCAGTG
>probe:Drosophila_2:1631406_at:422:85; Interrogation_Position=2574; Antisense; AGTGCGCCATGTTGAGCTCATTTTA
>probe:Drosophila_2:1631406_at:654:15; Interrogation_Position=2593; Antisense; ATTTTACAACCTGTTCCCGGAGCTG
>probe:Drosophila_2:1631406_at:435:71; Interrogation_Position=2649; Antisense; AGGAACTTTACCTAGTGCACAAACA
>probe:Drosophila_2:1631406_at:7:507; Interrogation_Position=2711; Antisense; GTGCCCGCGCTTGAAGTTTGCAAGG
>probe:Drosophila_2:1631406_at:474:517; Interrogation_Position=2735; Antisense; GTGTGCAAACAGATCCTCATCACCG
>probe:Drosophila_2:1631406_at:224:575; Interrogation_Position=2782; Antisense; GGCGCATGAGCTGACCAAAAACTTC
>probe:Drosophila_2:1631406_at:72:489; Interrogation_Position=2810; Antisense; GTACTCGGAAGCTCAGCCTCTAACA
>probe:Drosophila_2:1631406_at:59:15; Interrogation_Position=2905; Antisense; ATATACCGTGTCAACCATCTAGGAA
>probe:Drosophila_2:1631406_at:391:61; Interrogation_Position=2932; Antisense; ATGTCCCCAGATCATGTTGTGAGTG
>probe:Drosophila_2:1631406_at:380:381; Interrogation_Position=2979; Antisense; GAACCCATCAGTCCATGTAGCGCGA
>probe:Drosophila_2:1631406_at:429:379; Interrogation_Position=3009; Antisense; GAAGCCATCTGTTCAATGTGACTTA
>probe:Drosophila_2:1631406_at:256:377; Interrogation_Position=3043; Antisense; GAAGCTTATCTTGGATGCGTTTCTA
>probe:Drosophila_2:1631406_at:576:417; Interrogation_Position=3080; Antisense; GAGCTTGTGTCTAGCAAATGCCCGC

Paste this into a BLAST search page for me
AAGCCTATTACGAGCACTGCCAGTGAGTGCGCCATGTTGAGCTCATTTTAATTTTACAACCTGTTCCCGGAGCTGAGGAACTTTACCTAGTGCACAAACAGTGCCCGCGCTTGAAGTTTGCAAGGGTGTGCAAACAGATCCTCATCACCGGGCGCATGAGCTGACCAAAAACTTCGTACTCGGAAGCTCAGCCTCTAACAATATACCGTGTCAACCATCTAGGAAATGTCCCCAGATCATGTTGTGAGTGGAACCCATCAGTCCATGTAGCGCGAGAAGCCATCTGTTCAATGTGACTTAGAAGCTTATCTTGGATGCGTTTCTAGAGCTTGTGTCTAGCAAATGCCCGC

Full Affymetrix probeset data:

Annotations for 1631406_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720