Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631408_at:

>probe:Drosophila_2:1631408_at:510:249; Interrogation_Position=3471; Antisense; CAAATAAACTGTTGCCAATTACGGG
>probe:Drosophila_2:1631408_at:174:257; Interrogation_Position=3513; Antisense; CAAATTCGTTTGGTTTAGCATTTCA
>probe:Drosophila_2:1631408_at:155:479; Interrogation_Position=3525; Antisense; GTTTAGCATTTCATTTCCACTCACC
>probe:Drosophila_2:1631408_at:705:719; Interrogation_Position=3539; Antisense; TTCCACTCACCTTTTGCTGTACAAA
>probe:Drosophila_2:1631408_at:728:333; Interrogation_Position=3554; Antisense; GCTGTACAAAACATTCTCAGACATT
>probe:Drosophila_2:1631408_at:631:401; Interrogation_Position=3573; Antisense; GACATTAAATGTGCGTTCAATTGAA
>probe:Drosophila_2:1631408_at:678:647; Interrogation_Position=3589; Antisense; TCAATTGAAGGGAGCAACGGGACGC
>probe:Drosophila_2:1631408_at:464:411; Interrogation_Position=3609; Antisense; GACGCGGAATCAAGCACAAGTTTAG
>probe:Drosophila_2:1631408_at:223:165; Interrogation_Position=3859; Antisense; AAATCGAATCGAAGGCAAGCATCTA
>probe:Drosophila_2:1631408_at:423:371; Interrogation_Position=3869; Antisense; GAAGGCAAGCATCTACTGCATAATA
>probe:Drosophila_2:1631408_at:520:179; Interrogation_Position=3942; Antisense; AAACAAACCAAGAAGCAGCGTGCAA
>probe:Drosophila_2:1631408_at:20:115; Interrogation_Position=3955; Antisense; AGCAGCGTGCAAACGTGATTGTGAA
>probe:Drosophila_2:1631408_at:615:3; Interrogation_Position=3972; Antisense; ATTGTGAAACATGGCGCAAGGCAGC
>probe:Drosophila_2:1631408_at:330:179; Interrogation_Position=4017; Antisense; AAACATTGCCAAGCACCTGGAAATA

Paste this into a BLAST search page for me
CAAATAAACTGTTGCCAATTACGGGCAAATTCGTTTGGTTTAGCATTTCAGTTTAGCATTTCATTTCCACTCACCTTCCACTCACCTTTTGCTGTACAAAGCTGTACAAAACATTCTCAGACATTGACATTAAATGTGCGTTCAATTGAATCAATTGAAGGGAGCAACGGGACGCGACGCGGAATCAAGCACAAGTTTAGAAATCGAATCGAAGGCAAGCATCTAGAAGGCAAGCATCTACTGCATAATAAAACAAACCAAGAAGCAGCGTGCAAAGCAGCGTGCAAACGTGATTGTGAAATTGTGAAACATGGCGCAAGGCAGCAAACATTGCCAAGCACCTGGAAATA

Full Affymetrix probeset data:

Annotations for 1631408_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime