FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631412_at:

>probe:Drosophila_2:1631412_at:85:137; Interrogation_Position=2860; Antisense; ACGAGAGTGTGGGTCAGCTCAGCAA
>probe:Drosophila_2:1631412_at:218:143; Interrogation_Position=2892; Antisense; ACTGTGTTCCAGTCATCATCGAATA
>probe:Drosophila_2:1631412_at:472:41; Interrogation_Position=2909; Antisense; ATCGAATACGTCCAGTACCCCTAGT
>probe:Drosophila_2:1631412_at:352:469; Interrogation_Position=2932; Antisense; GTTCCCGAAGTTTTCAAGGATGCCA
>probe:Drosophila_2:1631412_at:30:447; Interrogation_Position=2950; Antisense; GATGCCAAGTCCAGTTTTTTCAGTC
>probe:Drosophila_2:1631412_at:62:637; Interrogation_Position=3015; Antisense; TCGGTTAACCGCTTAATCGGGAGAT
>probe:Drosophila_2:1631412_at:223:21; Interrogation_Position=3078; Antisense; ATATTGTAATATTCCCCGCGTTTTG
>probe:Drosophila_2:1631412_at:116:303; Interrogation_Position=3092; Antisense; CCCGCGTTTTGTTCCATGTACAAAT
>probe:Drosophila_2:1631412_at:611:697; Interrogation_Position=3125; Antisense; TTTTTCTGGACTTTCGCCTCGAATA
>probe:Drosophila_2:1631412_at:526:181; Interrogation_Position=3182; Antisense; AAAAAAGGGCCAGTCGCCGCCAGAG
>probe:Drosophila_2:1631412_at:703:299; Interrogation_Position=3196; Antisense; CGCCGCCAGAGGACAAAGTTTGCTT
>probe:Drosophila_2:1631412_at:72:431; Interrogation_Position=3227; Antisense; GAGTAGCACGTGTATTTGTTTCAGT
>probe:Drosophila_2:1631412_at:381:483; Interrogation_Position=3313; Antisense; GTATGCCCATTGTATAGTCTAAGTC
>probe:Drosophila_2:1631412_at:82:85; Interrogation_Position=3328; Antisense; AGTCTAAGTCCTAATCCAAACGATA

Paste this into a BLAST search page for me
ACGAGAGTGTGGGTCAGCTCAGCAAACTGTGTTCCAGTCATCATCGAATAATCGAATACGTCCAGTACCCCTAGTGTTCCCGAAGTTTTCAAGGATGCCAGATGCCAAGTCCAGTTTTTTCAGTCTCGGTTAACCGCTTAATCGGGAGATATATTGTAATATTCCCCGCGTTTTGCCCGCGTTTTGTTCCATGTACAAATTTTTTCTGGACTTTCGCCTCGAATAAAAAAAGGGCCAGTCGCCGCCAGAGCGCCGCCAGAGGACAAAGTTTGCTTGAGTAGCACGTGTATTTGTTTCAGTGTATGCCCATTGTATAGTCTAAGTCAGTCTAAGTCCTAATCCAAACGATA

Full Affymetrix probeset data:

Annotations for 1631412_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720