Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631414_at:

>probe:Drosophila_2:1631414_at:148:3; Interrogation_Position=1024; Antisense; ATTGTGTCCTTTGGCCTGAACTGCG
>probe:Drosophila_2:1631414_at:329:11; Interrogation_Position=1056; Antisense; ATTCTGGCCAGCTGTCTACACAAAT
>probe:Drosophila_2:1631414_at:51:443; Interrogation_Position=532; Antisense; GATGTCTCTTTCAGAGTCTCTGTGA
>probe:Drosophila_2:1631414_at:428:85; Interrogation_Position=577; Antisense; AGTGCCGTGGTGGATTGCCTCAATG
>probe:Drosophila_2:1631414_at:606:535; Interrogation_Position=605; Antisense; GGTGCCTACCGGAACCTGTGCAAAT
>probe:Drosophila_2:1631414_at:59:29; Interrogation_Position=649; Antisense; ATACATGAAAGCTTCGGTACCCGAT
>probe:Drosophila_2:1631414_at:167:487; Interrogation_Position=665; Antisense; GTACCCGATTGTTTTGGAACGACAT
>probe:Drosophila_2:1631414_at:182:403; Interrogation_Position=685; Antisense; GACATTGCTCTGATCCGTTTGGCGA
>probe:Drosophila_2:1631414_at:93:427; Interrogation_Position=708; Antisense; GAGAGAGGTTGCCTATTCGCCCAGC
>probe:Drosophila_2:1631414_at:730:121; Interrogation_Position=826; Antisense; AGCGAAAGCAGTCCCGTCAAGATGA
>probe:Drosophila_2:1631414_at:609:489; Interrogation_Position=859; Antisense; GTAACGTACGTGGAGCCTGGCCTGT
>probe:Drosophila_2:1631414_at:433:577; Interrogation_Position=877; Antisense; GGCCTGTGTCGTCGCAAGTATGCTA
>probe:Drosophila_2:1631414_at:498:675; Interrogation_Position=900; Antisense; TAGCATAGTGGTCCTGGGTGACTCC
>probe:Drosophila_2:1631414_at:540:143; Interrogation_Position=984; Antisense; ACTGATGGCATTCCACGAGGGCGTT

Paste this into a BLAST search page for me
ATTGTGTCCTTTGGCCTGAACTGCGATTCTGGCCAGCTGTCTACACAAATGATGTCTCTTTCAGAGTCTCTGTGAAGTGCCGTGGTGGATTGCCTCAATGGGTGCCTACCGGAACCTGTGCAAATATACATGAAAGCTTCGGTACCCGATGTACCCGATTGTTTTGGAACGACATGACATTGCTCTGATCCGTTTGGCGAGAGAGAGGTTGCCTATTCGCCCAGCAGCGAAAGCAGTCCCGTCAAGATGAGTAACGTACGTGGAGCCTGGCCTGTGGCCTGTGTCGTCGCAAGTATGCTATAGCATAGTGGTCCTGGGTGACTCCACTGATGGCATTCCACGAGGGCGTT

Full Affymetrix probeset data:

Annotations for 1631414_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime