FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631415_at:

>probe:Drosophila_2:1631415_at:41:725; Interrogation_Position=1018; Antisense; TTGCTTGCGCTCGAACAATCGTGTT
>probe:Drosophila_2:1631415_at:480:373; Interrogation_Position=1063; Antisense; GAAGTCGACCAGTCCCAAATCTGCA
>probe:Drosophila_2:1631415_at:371:321; Interrogation_Position=1139; Antisense; GCGCGAAGCTGCTCTTCGGGTTAAA
>probe:Drosophila_2:1631415_at:535:171; Interrogation_Position=1161; Antisense; AAAGAAGCGGGCTTTCCTGCTCGGA
>probe:Drosophila_2:1631415_at:494:629; Interrogation_Position=1207; Antisense; TCCTGTAGGATCTTCGAAGTGGCCA
>probe:Drosophila_2:1631415_at:358:581; Interrogation_Position=1226; Antisense; TGGCCACGAATGTGACGCACTACGT
>probe:Drosophila_2:1631415_at:25:347; Interrogation_Position=1242; Antisense; GCACTACGTCGACTGGATTAAGGCA
>probe:Drosophila_2:1631415_at:446:87; Interrogation_Position=695; Antisense; AGTCGCAGATTTGTGCTGCTGGCAC
>probe:Drosophila_2:1631415_at:144:163; Interrogation_Position=720; Antisense; AAATAGCGATGCATGCCACGGCGAC
>probe:Drosophila_2:1631415_at:575:599; Interrogation_Position=758; Antisense; TGAGCGCACAGGTTCCTTTTGCCGG
>probe:Drosophila_2:1631415_at:635:87; Interrogation_Position=800; Antisense; AGTACGGACTGGTCAGCTACGGGTC
>probe:Drosophila_2:1631415_at:490:81; Interrogation_Position=871; Antisense; AGGGACTGGATTCGAAGCCTCGCTT
>probe:Drosophila_2:1631415_at:581:633; Interrogation_Position=890; Antisense; TCGCTTTGACTGATTCCCCAGAATT
>probe:Drosophila_2:1631415_at:343:551; Interrogation_Position=936; Antisense; GGAGAAGGTTCACTTCTACACCCTC

Paste this into a BLAST search page for me
TTGCTTGCGCTCGAACAATCGTGTTGAAGTCGACCAGTCCCAAATCTGCAGCGCGAAGCTGCTCTTCGGGTTAAAAAAGAAGCGGGCTTTCCTGCTCGGATCCTGTAGGATCTTCGAAGTGGCCATGGCCACGAATGTGACGCACTACGTGCACTACGTCGACTGGATTAAGGCAAGTCGCAGATTTGTGCTGCTGGCACAAATAGCGATGCATGCCACGGCGACTGAGCGCACAGGTTCCTTTTGCCGGAGTACGGACTGGTCAGCTACGGGTCAGGGACTGGATTCGAAGCCTCGCTTTCGCTTTGACTGATTCCCCAGAATTGGAGAAGGTTCACTTCTACACCCTC

Full Affymetrix probeset data:

Annotations for 1631415_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720