Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631419_at:

>probe:Drosophila_2:1631419_at:209:467; Interrogation_Position=1001; Antisense; GTTGCGGCGATGTTGACTTCTACCC
>probe:Drosophila_2:1631419_at:726:717; Interrogation_Position=1046; Antisense; TTCCCGGCTCCGAGAATGTGATCGA
>probe:Drosophila_2:1631419_at:445:475; Interrogation_Position=1091; Antisense; GTTACTTTGCCGAGTCTGTGCGTCC
>probe:Drosophila_2:1631419_at:546:507; Interrogation_Position=1108; Antisense; GTGCGTCCCGGTAGCGAGCGCAATT
>probe:Drosophila_2:1631419_at:235:579; Interrogation_Position=1146; Antisense; GGCCAACTCGCTGAAGCAGTACAAG
>probe:Drosophila_2:1631419_at:119:441; Interrogation_Position=1177; Antisense; GATGGCTTTGGCAAGCGCGCCTACA
>probe:Drosophila_2:1631419_at:561:667; Interrogation_Position=1198; Antisense; TACATGGGTCTCCAGATCGACTACG
>probe:Drosophila_2:1631419_at:695:43; Interrogation_Position=1213; Antisense; ATCGACTACGATCTGCGCGGTGACT
>probe:Drosophila_2:1631419_at:222:625; Interrogation_Position=1226; Antisense; TGCGCGGTGACTACATCTTGGAGGT
>probe:Drosophila_2:1631419_at:114:549; Interrogation_Position=1245; Antisense; GGAGGTCAACGCCAAGAGCCCCTTC
>probe:Drosophila_2:1631419_at:191:285; Interrogation_Position=1353; Antisense; CTGGTTACCAGGGACGTTCGATCGT
>probe:Drosophila_2:1631419_at:500:451; Interrogation_Position=1372; Antisense; GATCGTCACGCACTTTCTGATAATC
>probe:Drosophila_2:1631419_at:570:129; Interrogation_Position=1408; Antisense; ACCCGGAATGCGTAGTTTAGCTTAG
>probe:Drosophila_2:1631419_at:440:725; Interrogation_Position=956; Antisense; TTGATGCCATTCACACATCGACCTT

Paste this into a BLAST search page for me
GTTGCGGCGATGTTGACTTCTACCCTTCCCGGCTCCGAGAATGTGATCGAGTTACTTTGCCGAGTCTGTGCGTCCGTGCGTCCCGGTAGCGAGCGCAATTGGCCAACTCGCTGAAGCAGTACAAGGATGGCTTTGGCAAGCGCGCCTACATACATGGGTCTCCAGATCGACTACGATCGACTACGATCTGCGCGGTGACTTGCGCGGTGACTACATCTTGGAGGTGGAGGTCAACGCCAAGAGCCCCTTCCTGGTTACCAGGGACGTTCGATCGTGATCGTCACGCACTTTCTGATAATCACCCGGAATGCGTAGTTTAGCTTAGTTGATGCCATTCACACATCGACCTT

Full Affymetrix probeset data:

Annotations for 1631419_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime