FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631420_at:

>probe:Drosophila_2:1631420_at:95:603; Interrogation_Position=1687; Antisense; TGTTACCATCAATCGGGCACCGTGA
>probe:Drosophila_2:1631420_at:234:63; Interrogation_Position=1714; Antisense; ATGGGCCCCGACTACGATAACGAGG
>probe:Drosophila_2:1631420_at:179:137; Interrogation_Position=1733; Antisense; ACGAGGCCTGTGTGAGTCAGCGTTT
>probe:Drosophila_2:1631420_at:117:497; Interrogation_Position=1748; Antisense; GTCAGCGTTTGAAGGTCCATGGATT
>probe:Drosophila_2:1631420_at:252:421; Interrogation_Position=1774; Antisense; GAGAACCTTAGAGTGGCGGATGCCA
>probe:Drosophila_2:1631420_at:460:627; Interrogation_Position=1794; Antisense; TGCCAGCATAATGCCAGCGGTGGTC
>probe:Drosophila_2:1631420_at:71:665; Interrogation_Position=1827; Antisense; TACAAATGCGGCCACGGTGATGATT
>probe:Drosophila_2:1631420_at:23:577; Interrogation_Position=1863; Antisense; GGCCCACTTCATCCAGGAGGATTAC
>probe:Drosophila_2:1631420_at:332:351; Interrogation_Position=1897; Antisense; GCAGTTGGCGCCAATGGAGGTCTAT
>probe:Drosophila_2:1631420_at:580:79; Interrogation_Position=1914; Antisense; AGGTCTATGGGTGCCGCATATGCAT
>probe:Drosophila_2:1631420_at:340:443; Interrogation_Position=1957; Antisense; GATGATTCCAAACACAGAACTCGTT
>probe:Drosophila_2:1631420_at:399:383; Interrogation_Position=1973; Antisense; GAACTCGTTTCGATTGGCAACTTGT
>probe:Drosophila_2:1631420_at:163:261; Interrogation_Position=2092; Antisense; CACCCTTTCCTTTGCATTACGAGAA
>probe:Drosophila_2:1631420_at:687:669; Interrogation_Position=2122; Antisense; TTAGCAACAAGTTTAGCCCACGTTT

Paste this into a BLAST search page for me
TGTTACCATCAATCGGGCACCGTGAATGGGCCCCGACTACGATAACGAGGACGAGGCCTGTGTGAGTCAGCGTTTGTCAGCGTTTGAAGGTCCATGGATTGAGAACCTTAGAGTGGCGGATGCCATGCCAGCATAATGCCAGCGGTGGTCTACAAATGCGGCCACGGTGATGATTGGCCCACTTCATCCAGGAGGATTACGCAGTTGGCGCCAATGGAGGTCTATAGGTCTATGGGTGCCGCATATGCATGATGATTCCAAACACAGAACTCGTTGAACTCGTTTCGATTGGCAACTTGTCACCCTTTCCTTTGCATTACGAGAATTAGCAACAAGTTTAGCCCACGTTT

Full Affymetrix probeset data:

Annotations for 1631420_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720