FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631425_at:

>probe:Drosophila_2:1631425_at:438:207; Interrogation_Position=1001; Antisense; AAGCATGTGTACAAGCCGTGTCCTT
>probe:Drosophila_2:1631425_at:712:125; Interrogation_Position=1014; Antisense; AGCCGTGTCCTTGATAGATATTCAG
>probe:Drosophila_2:1631425_at:535:77; Interrogation_Position=495; Antisense; AGGATGTCATGGAGCGCTGCCGCAA
>probe:Drosophila_2:1631425_at:170:47; Interrogation_Position=530; Antisense; ATCCGCCTGGCCAACATAATGATCG
>probe:Drosophila_2:1631425_at:90:133; Interrogation_Position=560; Antisense; ACCGCCGTGGGATGCGCCATTATGG
>probe:Drosophila_2:1631425_at:41:601; Interrogation_Position=585; Antisense; TGTACAGTGGCAAGCAGGCCGCCAA
>probe:Drosophila_2:1631425_at:372:99; Interrogation_Position=630; Antisense; AGATGAATCTCGAGTGGCACAAACA
>probe:Drosophila_2:1631425_at:303:189; Interrogation_Position=651; Antisense; AACAGTTTAATGACTCTCAGCAGAG
>probe:Drosophila_2:1631425_at:129:337; Interrogation_Position=686; Antisense; GCTCCGGCCGCCAAATAGAAAATCA
>probe:Drosophila_2:1631425_at:283:677; Interrogation_Position=701; Antisense; TAGAAAATCACTCCGAAATCCCTCA
>probe:Drosophila_2:1631425_at:672:633; Interrogation_Position=719; Antisense; TCCCTCACTCGCCTAGTAATATTAG
>probe:Drosophila_2:1631425_at:564:11; Interrogation_Position=739; Antisense; ATTAGAACTGGCCAGGCTTCCATTT
>probe:Drosophila_2:1631425_at:382:569; Interrogation_Position=753; Antisense; GGCTTCCATTTTCACTTCCAAAGAA
>probe:Drosophila_2:1631425_at:131:725; Interrogation_Position=949; Antisense; TTGCAGGGCCAAATCTTTAGTGAAT

Paste this into a BLAST search page for me
AAGCATGTGTACAAGCCGTGTCCTTAGCCGTGTCCTTGATAGATATTCAGAGGATGTCATGGAGCGCTGCCGCAAATCCGCCTGGCCAACATAATGATCGACCGCCGTGGGATGCGCCATTATGGTGTACAGTGGCAAGCAGGCCGCCAAAGATGAATCTCGAGTGGCACAAACAAACAGTTTAATGACTCTCAGCAGAGGCTCCGGCCGCCAAATAGAAAATCATAGAAAATCACTCCGAAATCCCTCATCCCTCACTCGCCTAGTAATATTAGATTAGAACTGGCCAGGCTTCCATTTGGCTTCCATTTTCACTTCCAAAGAATTGCAGGGCCAAATCTTTAGTGAAT

Full Affymetrix probeset data:

Annotations for 1631425_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720