FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631426_at:

>probe:Drosophila_2:1631426_at:554:477; Interrogation_Position=1003; Antisense; GTTTATCAATACCTTAAGCGGCACA
>probe:Drosophila_2:1631426_at:678:205; Interrogation_Position=1018; Antisense; AAGCGGCACACGTCACCAGTGAATT
>probe:Drosophila_2:1631426_at:514:505; Interrogation_Position=1036; Antisense; GTGAATTTGCGTTTTTACCGAACAT
>probe:Drosophila_2:1631426_at:664:51; Interrogation_Position=572; Antisense; ATGCGGACTCTGTATACGGATCAAA
>probe:Drosophila_2:1631426_at:285:545; Interrogation_Position=589; Antisense; GGATCAAAGCATCTGGCCGCGAAGT
>probe:Drosophila_2:1631426_at:530:571; Interrogation_Position=615; Antisense; GGCTAGCAAACGCAGTGGTTCCCAG
>probe:Drosophila_2:1631426_at:395:323; Interrogation_Position=640; Antisense; GCGCAACTAGCTCCACGCAATATAG
>probe:Drosophila_2:1631426_at:30:473; Interrogation_Position=676; Antisense; GTTCTGGTGCTGCTGGATCTAATTG
>probe:Drosophila_2:1631426_at:675:245; Interrogation_Position=708; Antisense; GAATCCCAAGTTCTCCAGTTTTTAT
>probe:Drosophila_2:1631426_at:189:7; Interrogation_Position=769; Antisense; ATTGAGAAATCTCTGCGCACTGCCG
>probe:Drosophila_2:1631426_at:494:653; Interrogation_Position=824; Antisense; TAAGTCGTGTCAGCGGTGGTCTAGT
>probe:Drosophila_2:1631426_at:72:295; Interrogation_Position=852; Antisense; CGATGATCATCGACCGTTTTTAGAT
>probe:Drosophila_2:1631426_at:580:369; Interrogation_Position=879; Antisense; GAATGTTCCTGTGCTGCATTTGGTA
>probe:Drosophila_2:1631426_at:156:143; Interrogation_Position=959; Antisense; ACTGGCCTTCCATACGCAATTTCAA

Paste this into a BLAST search page for me
GTTTATCAATACCTTAAGCGGCACAAAGCGGCACACGTCACCAGTGAATTGTGAATTTGCGTTTTTACCGAACATATGCGGACTCTGTATACGGATCAAAGGATCAAAGCATCTGGCCGCGAAGTGGCTAGCAAACGCAGTGGTTCCCAGGCGCAACTAGCTCCACGCAATATAGGTTCTGGTGCTGCTGGATCTAATTGGAATCCCAAGTTCTCCAGTTTTTATATTGAGAAATCTCTGCGCACTGCCGTAAGTCGTGTCAGCGGTGGTCTAGTCGATGATCATCGACCGTTTTTAGATGAATGTTCCTGTGCTGCATTTGGTAACTGGCCTTCCATACGCAATTTCAA

Full Affymetrix probeset data:

Annotations for 1631426_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720