FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631430_at:

>probe:Drosophila_2:1631430_at:328:333; Interrogation_Position=2860; Antisense; GCTGGCTGAGATTCACTACGTGAAG
>probe:Drosophila_2:1631430_at:365:107; Interrogation_Position=2904; Antisense; AGAACTCGGTTATTCTCGTGCACAT
>probe:Drosophila_2:1631430_at:395:41; Interrogation_Position=2927; Antisense; ATCGGCGCCATGCAATTCTACATGA
>probe:Drosophila_2:1631430_at:131:225; Interrogation_Position=2957; Antisense; AAGGATCTGTCGCTGCAGACGCTAA
>probe:Drosophila_2:1631430_at:67:77; Interrogation_Position=3084; Antisense; AGGAGCTCAAGGAAGTCGTGCCCAA
>probe:Drosophila_2:1631430_at:587:639; Interrogation_Position=3113; Antisense; TCGGTGGTGTTCTATCTGATCGGCA
>probe:Drosophila_2:1631430_at:241:213; Interrogation_Position=3146; Antisense; AAGACGCTCGGCAACATGGATCTGG
>probe:Drosophila_2:1631430_at:660:65; Interrogation_Position=3161; Antisense; ATGGATCTGGCGCTGATGCACTTCA
>probe:Drosophila_2:1631430_at:105:99; Interrogation_Position=3232; Antisense; AGATGCCTTCGACTCAATGGCTCAT
>probe:Drosophila_2:1631430_at:663:139; Interrogation_Position=3281; Antisense; ACGGCCCTGGACGTTGATCTGGAGC
>probe:Drosophila_2:1631430_at:725:451; Interrogation_Position=3296; Antisense; GATCTGGAGCCCACTTCGGAGCGTT
>probe:Drosophila_2:1631430_at:68:555; Interrogation_Position=3313; Antisense; GGAGCGTTCCGATGACTCGACGCAG
>probe:Drosophila_2:1631430_at:146:561; Interrogation_Position=3350; Antisense; GGAAGCTACGACAGCGACTACTAGG
>probe:Drosophila_2:1631430_at:574:417; Interrogation_Position=3375; Antisense; GAGCTGCAACTCCAAATTCACGCGG

Paste this into a BLAST search page for me
GCTGGCTGAGATTCACTACGTGAAGAGAACTCGGTTATTCTCGTGCACATATCGGCGCCATGCAATTCTACATGAAAGGATCTGTCGCTGCAGACGCTAAAGGAGCTCAAGGAAGTCGTGCCCAATCGGTGGTGTTCTATCTGATCGGCAAAGACGCTCGGCAACATGGATCTGGATGGATCTGGCGCTGATGCACTTCAAGATGCCTTCGACTCAATGGCTCATACGGCCCTGGACGTTGATCTGGAGCGATCTGGAGCCCACTTCGGAGCGTTGGAGCGTTCCGATGACTCGACGCAGGGAAGCTACGACAGCGACTACTAGGGAGCTGCAACTCCAAATTCACGCGG

Full Affymetrix probeset data:

Annotations for 1631430_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720