FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631432_at:

>probe:Drosophila_2:1631432_at:575:661; Interrogation_Position=1003; Antisense; TAACAAATCGCCATACCTGCTCTAT
>probe:Drosophila_2:1631432_at:685:41; Interrogation_Position=1029; Antisense; ATCGAGATTATCGTGCTCCGGCGGA
>probe:Drosophila_2:1631432_at:722:151; Interrogation_Position=1059; Antisense; ACATCTTTCCACTTATTGTGCGCAA
>probe:Drosophila_2:1631432_at:610:483; Interrogation_Position=1126; Antisense; TGGCCGTTAAACAGCTTACCCGATA
>probe:Drosophila_2:1631432_at:173:603; Interrogation_Position=1202; Antisense; TGATTACGTTTTTCTAGCCCTAGTC
>probe:Drosophila_2:1631432_at:149:679; Interrogation_Position=1222; Antisense; TAGTCGAAACAGCTATGCACCCGCG
>probe:Drosophila_2:1631432_at:271:281; Interrogation_Position=1310; Antisense; CTCCACCGCCTACATTTAAGATTTT
>probe:Drosophila_2:1631432_at:257:541; Interrogation_Position=1339; Antisense; GGTTATGGTACACACACGCACAGGC
>probe:Drosophila_2:1631432_at:606:249; Interrogation_Position=808; Antisense; CAAGGTACGTTTGCCGCCATATGTC
>probe:Drosophila_2:1631432_at:708:615; Interrogation_Position=836; Antisense; TGCACACAGTGCGTACTCCAATGGA
>probe:Drosophila_2:1631432_at:157:555; Interrogation_Position=858; Antisense; GGACCTACTATACGGCCAATATGTG
>probe:Drosophila_2:1631432_at:471:565; Interrogation_Position=920; Antisense; GGCAAGGCAGAGACATTCCGCAATT
>probe:Drosophila_2:1631432_at:566:405; Interrogation_Position=958; Antisense; GATCGTTTCGAATACCGGCGGCGGT
>probe:Drosophila_2:1631432_at:160:721; Interrogation_Position=984; Antisense; TTCCACCGCCTTTCGTGAATAACAA

Paste this into a BLAST search page for me
TAACAAATCGCCATACCTGCTCTATATCGAGATTATCGTGCTCCGGCGGAACATCTTTCCACTTATTGTGCGCAATGGCCGTTAAACAGCTTACCCGATATGATTACGTTTTTCTAGCCCTAGTCTAGTCGAAACAGCTATGCACCCGCGCTCCACCGCCTACATTTAAGATTTTGGTTATGGTACACACACGCACAGGCCAAGGTACGTTTGCCGCCATATGTCTGCACACAGTGCGTACTCCAATGGAGGACCTACTATACGGCCAATATGTGGGCAAGGCAGAGACATTCCGCAATTGATCGTTTCGAATACCGGCGGCGGTTTCCACCGCCTTTCGTGAATAACAA

Full Affymetrix probeset data:

Annotations for 1631432_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720