Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631433_at:

>probe:Drosophila_2:1631433_at:515:723; Interrogation_Position=2299; Antisense; TTGCAGCTCACCCACATAGATGGTA
>probe:Drosophila_2:1631433_at:369:655; Interrogation_Position=2322; Antisense; TAATCCCGTGGAACTGAAGCGCAGC
>probe:Drosophila_2:1631433_at:364:379; Interrogation_Position=2337; Antisense; GAAGCGCAGCGATCGTGTGCTCAAA
>probe:Drosophila_2:1631433_at:109:653; Interrogation_Position=2370; Antisense; TAATGATGGCGCACAACGTCGACTG
>probe:Drosophila_2:1631433_at:618:139; Interrogation_Position=2385; Antisense; ACGTCGACTGGCCTCACAGAAGAAG
>probe:Drosophila_2:1631433_at:650:393; Interrogation_Position=2435; Antisense; GAAATATTCCCTTCCAGGCACAATA
>probe:Drosophila_2:1631433_at:71:225; Interrogation_Position=2482; Antisense; AAGGCTTTTGGCGAACTGCGATCCT
>probe:Drosophila_2:1631433_at:641:283; Interrogation_Position=2497; Antisense; CTGCGATCCTTACGTATTCCTAAAA
>probe:Drosophila_2:1631433_at:242:547; Interrogation_Position=2538; Antisense; GGATGCGCATCGTGGTTTCGGTTTC
>probe:Drosophila_2:1631433_at:502:693; Interrogation_Position=2553; Antisense; TTTCGGTTTCGTTGACTACATGTCC
>probe:Drosophila_2:1631433_at:533:57; Interrogation_Position=2617; Antisense; AGTACGCATCTTTACGGTCGTCGTT
>probe:Drosophila_2:1631433_at:476:129; Interrogation_Position=2672; Antisense; ACCAGGACGTGGAGGAGCTTCGCAA
>probe:Drosophila_2:1631433_at:126:165; Interrogation_Position=2755; Antisense; AAATCCTTCTTCGATGTGGAGGGCA
>probe:Drosophila_2:1631433_at:282:681; Interrogation_Position=2821; Antisense; TAGGCCTCAGGCGTAGCTTGAAAGT

Paste this into a BLAST search page for me
TTGCAGCTCACCCACATAGATGGTATAATCCCGTGGAACTGAAGCGCAGCGAAGCGCAGCGATCGTGTGCTCAAATAATGATGGCGCACAACGTCGACTGACGTCGACTGGCCTCACAGAAGAAGGAAATATTCCCTTCCAGGCACAATAAAGGCTTTTGGCGAACTGCGATCCTCTGCGATCCTTACGTATTCCTAAAAGGATGCGCATCGTGGTTTCGGTTTCTTTCGGTTTCGTTGACTACATGTCCAGTACGCATCTTTACGGTCGTCGTTACCAGGACGTGGAGGAGCTTCGCAAAAATCCTTCTTCGATGTGGAGGGCATAGGCCTCAGGCGTAGCTTGAAAGT

Full Affymetrix probeset data:

Annotations for 1631433_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime