FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631434_at:

>probe:Drosophila_2:1631434_at:721:581; Interrogation_Position=115; Antisense; TGGCCCGCACCGTTCTGGTGCAAAA
>probe:Drosophila_2:1631434_at:256:75; Interrogation_Position=151; Antisense; AGGAGGCGTGTCGTCTGTTAAATCG
>probe:Drosophila_2:1631434_at:297:289; Interrogation_Position=162; Antisense; CGTCTGTTAAATCGCGTCTTGGGAA
>probe:Drosophila_2:1631434_at:487:107; Interrogation_Position=191; Antisense; AGAACTGCTCGACCAATTTCGCCGC
>probe:Drosophila_2:1631434_at:384:633; Interrogation_Position=209; Antisense; TCGCCGCACGCGATTCTACGAAAAG
>probe:Drosophila_2:1631434_at:440:537; Interrogation_Position=22; Antisense; GGTCACACTGTTTTGAAAGCCGATT
>probe:Drosophila_2:1631434_at:713:165; Interrogation_Position=229; Antisense; AAAAGCCGTATCAGGTTCGTCGTCG
>probe:Drosophila_2:1631434_at:624:717; Interrogation_Position=244; Antisense; TTCGTCGTCGCATCAACTTCGAGAA
>probe:Drosophila_2:1631434_at:477:53; Interrogation_Position=269; Antisense; ATGCAAGGCCATTTACAACGAGGAC
>probe:Drosophila_2:1631434_at:483:389; Interrogation_Position=301; Antisense; GAAAAATTCAGTTCGTACTGCGCAA
>probe:Drosophila_2:1631434_at:73:489; Interrogation_Position=315; Antisense; GTACTGCGCAAAAATCGCGCCGAAC
>probe:Drosophila_2:1631434_at:473:303; Interrogation_Position=334; Antisense; CCGAACCTTTTCCTGGATGCAGTTA
>probe:Drosophila_2:1631434_at:340:193; Interrogation_Position=81; Antisense; AACTACTTATCCGAAATGAGACACG
>probe:Drosophila_2:1631434_at:542:57; Interrogation_Position=96; Antisense; ATGAGACACGTGCAGTTTCTGGCCC

Paste this into a BLAST search page for me
TGGCCCGCACCGTTCTGGTGCAAAAAGGAGGCGTGTCGTCTGTTAAATCGCGTCTGTTAAATCGCGTCTTGGGAAAGAACTGCTCGACCAATTTCGCCGCTCGCCGCACGCGATTCTACGAAAAGGGTCACACTGTTTTGAAAGCCGATTAAAAGCCGTATCAGGTTCGTCGTCGTTCGTCGTCGCATCAACTTCGAGAAATGCAAGGCCATTTACAACGAGGACGAAAAATTCAGTTCGTACTGCGCAAGTACTGCGCAAAAATCGCGCCGAACCCGAACCTTTTCCTGGATGCAGTTAAACTACTTATCCGAAATGAGACACGATGAGACACGTGCAGTTTCTGGCCC

Full Affymetrix probeset data:

Annotations for 1631434_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720