FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631436_at:

>probe:Drosophila_2:1631436_at:83:47; Interrogation_Position=1000; Antisense; ATCCGCGCTCAATTATATGACAGTC
>probe:Drosophila_2:1631436_at:527:399; Interrogation_Position=1018; Antisense; GACAGTCCAAATTAACTTTGCAAGT
>probe:Drosophila_2:1631436_at:360:713; Interrogation_Position=698; Antisense; TTCTCCACAAACCAATACCCAGTGG
>probe:Drosophila_2:1631436_at:91:29; Interrogation_Position=712; Antisense; ATACCCAGTGGCTGAGGGCAGATGC
>probe:Drosophila_2:1631436_at:576:281; Interrogation_Position=832; Antisense; CGGACCCTTCGGACCAGGCTGTGGT
>probe:Drosophila_2:1631436_at:579:283; Interrogation_Position=880; Antisense; CGGACCTGGCCCTTGTGGCTTCGGT
>probe:Drosophila_2:1631436_at:276:729; Interrogation_Position=892; Antisense; TTGTGGCTTCGGTCCTTGCGGACCA
>probe:Drosophila_2:1631436_at:478:275; Interrogation_Position=906; Antisense; CTTGCGGACCATGCTGATCTGTAAA
>probe:Drosophila_2:1631436_at:330:661; Interrogation_Position=927; Antisense; TAAAACAGCTGGAAAGATCTACTTG
>probe:Drosophila_2:1631436_at:130:171; Interrogation_Position=939; Antisense; AAAGATCTACTTGACGTCTGCCAAA
>probe:Drosophila_2:1631436_at:217:665; Interrogation_Position=946; Antisense; TACTTGACGTCTGCCAAAAACATTT
>probe:Drosophila_2:1631436_at:385:179; Interrogation_Position=963; Antisense; AAACATTTTGTGACAACTCCGCGTT
>probe:Drosophila_2:1631436_at:305:193; Interrogation_Position=977; Antisense; AACTCCGCGTTATGGAAGTCCACAT
>probe:Drosophila_2:1631436_at:275:705; Interrogation_Position=986; Antisense; TTATGGAAGTCCACATCCGCGCTCA

Paste this into a BLAST search page for me
ATCCGCGCTCAATTATATGACAGTCGACAGTCCAAATTAACTTTGCAAGTTTCTCCACAAACCAATACCCAGTGGATACCCAGTGGCTGAGGGCAGATGCCGGACCCTTCGGACCAGGCTGTGGTCGGACCTGGCCCTTGTGGCTTCGGTTTGTGGCTTCGGTCCTTGCGGACCACTTGCGGACCATGCTGATCTGTAAATAAAACAGCTGGAAAGATCTACTTGAAAGATCTACTTGACGTCTGCCAAATACTTGACGTCTGCCAAAAACATTTAAACATTTTGTGACAACTCCGCGTTAACTCCGCGTTATGGAAGTCCACATTTATGGAAGTCCACATCCGCGCTCA

Full Affymetrix probeset data:

Annotations for 1631436_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720