Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631437_at:

>probe:Drosophila_2:1631437_at:631:661; Interrogation_Position=458; Antisense; TAAAGGACGCCGGACACTACAGAAA
>probe:Drosophila_2:1631437_at:494:75; Interrogation_Position=461; Antisense; AGGACGCCGGACACTACAGAAAAAG
>probe:Drosophila_2:1631437_at:123:411; Interrogation_Position=463; Antisense; GACGCCGGACACTACAGAAAAAGAA
>probe:Drosophila_2:1631437_at:414:399; Interrogation_Position=470; Antisense; GACACTACAGAAAAAGAACTCCCTC
>probe:Drosophila_2:1631437_at:647:383; Interrogation_Position=485; Antisense; GAACTCCCTCTTTTTCTACTATACA
>probe:Drosophila_2:1631437_at:685:193; Interrogation_Position=486; Antisense; AACTCCCTCTTTTTCTACTATACAG
>probe:Drosophila_2:1631437_at:476:281; Interrogation_Position=488; Antisense; CTCCCTCTTTTTCTACTATACAGTG
>probe:Drosophila_2:1631437_at:174:633; Interrogation_Position=489; Antisense; TCCCTCTTTTTCTACTATACAGTGC
>probe:Drosophila_2:1631437_at:404:281; Interrogation_Position=492; Antisense; CTCTTTTTCTACTATACAGTGCACA
>probe:Drosophila_2:1631437_at:502:697; Interrogation_Position=495; Antisense; TTTTTCTACTATACAGTGCACAAAC
>probe:Drosophila_2:1631437_at:169:645; Interrogation_Position=501; Antisense; TACTATACAGTGCACAAACAACAGG
>probe:Drosophila_2:1631437_at:477:665; Interrogation_Position=506; Antisense; TACAGTGCACAAACAACAGGGTACT
>probe:Drosophila_2:1631437_at:472:469; Interrogation_Position=510; Antisense; GTGCACAAACAACAGGGTACTTGCG
>probe:Drosophila_2:1631437_at:155:255; Interrogation_Position=515; Antisense; CAAACAACAGGGTACTTGCGAATTA

Paste this into a BLAST search page for me
TAAAGGACGCCGGACACTACAGAAAAGGACGCCGGACACTACAGAAAAAGGACGCCGGACACTACAGAAAAAGAAGACACTACAGAAAAAGAACTCCCTCGAACTCCCTCTTTTTCTACTATACAAACTCCCTCTTTTTCTACTATACAGCTCCCTCTTTTTCTACTATACAGTGTCCCTCTTTTTCTACTATACAGTGCCTCTTTTTCTACTATACAGTGCACATTTTTCTACTATACAGTGCACAAACTACTATACAGTGCACAAACAACAGGTACAGTGCACAAACAACAGGGTACTGTGCACAAACAACAGGGTACTTGCGCAAACAACAGGGTACTTGCGAATTA

Full Affymetrix probeset data:

Annotations for 1631437_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime