Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631438_a_at:

>probe:Drosophila_2:1631438_a_at:686:375; Interrogation_Position=1004; Antisense; GAAGACTCTGGCAAATGGTGATCAT
>probe:Drosophila_2:1631438_a_at:195:263; Interrogation_Position=1036; Antisense; CAGCGACCGGCTAAGATTTTTGGAT
>probe:Drosophila_2:1631438_a_at:578:11; Interrogation_Position=1059; Antisense; ATTCATGTTCGTTGTGGACTTGCCA
>probe:Drosophila_2:1631438_a_at:618:537; Interrogation_Position=1149; Antisense; GGTCATCAGAACTGCGGGCTCATTT
>probe:Drosophila_2:1631438_a_at:467:17; Interrogation_Position=1170; Antisense; ATTTCTGGCCATGCTTAGGACTTTC
>probe:Drosophila_2:1631438_a_at:563:715; Interrogation_Position=610; Antisense; TTCTCCTGGCTGACTCACAATGTGG
>probe:Drosophila_2:1631438_a_at:678:515; Interrogation_Position=631; Antisense; GTGGTGATTCAGTTCCAACTACTGG
>probe:Drosophila_2:1631438_a_at:292:193; Interrogation_Position=647; Antisense; AACTACTGGAGCTTGTTCTCGAAGA
>probe:Drosophila_2:1631438_a_at:238:413; Interrogation_Position=702; Antisense; GACCGGGTTTGTTAGTCGTCATCGT
>probe:Drosophila_2:1631438_a_at:385:501; Interrogation_Position=716; Antisense; GTCGTCATCGTATAGCTCTGGATTT
>probe:Drosophila_2:1631438_a_at:608:29; Interrogation_Position=786; Antisense; ATACATGCTCAGTTACCTGCAACTC
>probe:Drosophila_2:1631438_a_at:529:193; Interrogation_Position=806; Antisense; AACTCTGCATGTTGGCCTTTCGCTT
>probe:Drosophila_2:1631438_a_at:541:171; Interrogation_Position=938; Antisense; AAAGTTTGGCCATCGCACAAGCCGT
>probe:Drosophila_2:1631438_a_at:148:357; Interrogation_Position=952; Antisense; GCACAAGCCGTTTATGGTCAAATCA

Paste this into a BLAST search page for me
GAAGACTCTGGCAAATGGTGATCATCAGCGACCGGCTAAGATTTTTGGATATTCATGTTCGTTGTGGACTTGCCAGGTCATCAGAACTGCGGGCTCATTTATTTCTGGCCATGCTTAGGACTTTCTTCTCCTGGCTGACTCACAATGTGGGTGGTGATTCAGTTCCAACTACTGGAACTACTGGAGCTTGTTCTCGAAGAGACCGGGTTTGTTAGTCGTCATCGTGTCGTCATCGTATAGCTCTGGATTTATACATGCTCAGTTACCTGCAACTCAACTCTGCATGTTGGCCTTTCGCTTAAAGTTTGGCCATCGCACAAGCCGTGCACAAGCCGTTTATGGTCAAATCA

Full Affymetrix probeset data:

Annotations for 1631438_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime