FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631439_at:

>probe:Drosophila_2:1631439_at:29:555; Interrogation_Position=1030; Antisense; GGACCCAGCTGCGATGCTATGGATA
>probe:Drosophila_2:1631439_at:712:215; Interrogation_Position=1054; Antisense; AAGATATCGGACTTGCTATTGCCCA
>probe:Drosophila_2:1631439_at:650:365; Interrogation_Position=1083; Antisense; GAATCCGGGCGATCTATTAGGCTTT
>probe:Drosophila_2:1631439_at:531:43; Interrogation_Position=1135; Antisense; ATCGCCAGTCCCTTTAATGGATTCG
>probe:Drosophila_2:1631439_at:541:59; Interrogation_Position=1160; Antisense; ATGTTCCGGAGACCAGGTTCTTCAA
>probe:Drosophila_2:1631439_at:166:291; Interrogation_Position=699; Antisense; CGGTGGCTTTCCTGGCATTGATGAT
>probe:Drosophila_2:1631439_at:168:419; Interrogation_Position=766; Antisense; GAGCTGCGTTTTCCCGATAAGCGTA
>probe:Drosophila_2:1631439_at:575:483; Interrogation_Position=788; Antisense; GTATCCGAATCATTTCCGAGCCAGG
>probe:Drosophila_2:1631439_at:15:411; Interrogation_Position=812; Antisense; GACGCTTCTTTGTGGAGGCCGCATA
>probe:Drosophila_2:1631439_at:93:589; Interrogation_Position=824; Antisense; TGGAGGCCGCATACACATTGATCTG
>probe:Drosophila_2:1631439_at:724:557; Interrogation_Position=894; Antisense; GGACACCATGATGTACTACCTGAAT
>probe:Drosophila_2:1631439_at:69:585; Interrogation_Position=921; Antisense; TGGAATCTTCGGAGCGTTCGCAGGA
>probe:Drosophila_2:1631439_at:356:563; Interrogation_Position=943; Antisense; GGAATGTTTTACTACCCTGAAGAGG
>probe:Drosophila_2:1631439_at:245:419; Interrogation_Position=976; Antisense; GAGCTCTACTTGGACGAAGCCGAGA

Paste this into a BLAST search page for me
GGACCCAGCTGCGATGCTATGGATAAAGATATCGGACTTGCTATTGCCCAGAATCCGGGCGATCTATTAGGCTTTATCGCCAGTCCCTTTAATGGATTCGATGTTCCGGAGACCAGGTTCTTCAACGGTGGCTTTCCTGGCATTGATGATGAGCTGCGTTTTCCCGATAAGCGTAGTATCCGAATCATTTCCGAGCCAGGGACGCTTCTTTGTGGAGGCCGCATATGGAGGCCGCATACACATTGATCTGGGACACCATGATGTACTACCTGAATTGGAATCTTCGGAGCGTTCGCAGGAGGAATGTTTTACTACCCTGAAGAGGGAGCTCTACTTGGACGAAGCCGAGA

Full Affymetrix probeset data:

Annotations for 1631439_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720