FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631440_at:

>probe:Drosophila_2:1631440_at:275:661; Interrogation_Position=158; Antisense; TAAAATCCAATCCTACAGCCAAGTC
>probe:Drosophila_2:1631440_at:562:219; Interrogation_Position=178; Antisense; AAGTCCGCCATACAGGCTCACGAAA
>probe:Drosophila_2:1631440_at:101:437; Interrogation_Position=211; Antisense; GAGGACGACGACTTCCACAACGATC
>probe:Drosophila_2:1631440_at:276:495; Interrogation_Position=236; Antisense; GTCTTCCCGCCTTATCAGAGGATGA
>probe:Drosophila_2:1631440_at:76:203; Interrogation_Position=268; Antisense; AACCTGAGTGAGGACGCCAATCCGC
>probe:Drosophila_2:1631440_at:149:359; Interrogation_Position=306; Antisense; GCAACAGCCCCTGGATCTTGAAAAT
>probe:Drosophila_2:1631440_at:8:351; Interrogation_Position=342; Antisense; GCAGAAGCCTGAATCTCAAACCGAG
>probe:Drosophila_2:1631440_at:85:201; Interrogation_Position=360; Antisense; AACCGAGAGTAAGCCAGATCCGCAA
>probe:Drosophila_2:1631440_at:593:97; Interrogation_Position=375; Antisense; AGATCCGCAAGTGATGGCTCCACAA
>probe:Drosophila_2:1631440_at:61:493; Interrogation_Position=452; Antisense; GTAAGCTGCCCATTAGTTTGACCAT
>probe:Drosophila_2:1631440_at:113:111; Interrogation_Position=530; Antisense; AGAATCACTCTACCAAATCACCGAA
>probe:Drosophila_2:1631440_at:637:383; Interrogation_Position=552; Antisense; GAACTCGTTCTTCAATCGCTTGCTG
>probe:Drosophila_2:1631440_at:688:617; Interrogation_Position=575; Antisense; TGCAGCAGATTGAGTCTCCCAAGAG
>probe:Drosophila_2:1631440_at:429:95; Interrogation_Position=695; Antisense; AGATTTTGCTTCATAGCCCAATGCA

Paste this into a BLAST search page for me
TAAAATCCAATCCTACAGCCAAGTCAAGTCCGCCATACAGGCTCACGAAAGAGGACGACGACTTCCACAACGATCGTCTTCCCGCCTTATCAGAGGATGAAACCTGAGTGAGGACGCCAATCCGCGCAACAGCCCCTGGATCTTGAAAATGCAGAAGCCTGAATCTCAAACCGAGAACCGAGAGTAAGCCAGATCCGCAAAGATCCGCAAGTGATGGCTCCACAAGTAAGCTGCCCATTAGTTTGACCATAGAATCACTCTACCAAATCACCGAAGAACTCGTTCTTCAATCGCTTGCTGTGCAGCAGATTGAGTCTCCCAAGAGAGATTTTGCTTCATAGCCCAATGCA

Full Affymetrix probeset data:

Annotations for 1631440_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720