FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631442_at:

>probe:Drosophila_2:1631442_at:543:383; Interrogation_Position=1019; Antisense; GAACTTGTACGTTTGGTCATCACCG
>probe:Drosophila_2:1631442_at:685:221; Interrogation_Position=1055; Antisense; AAGGGTTTTATGTTCCACGGCATCA
>probe:Drosophila_2:1631442_at:57:65; Interrogation_Position=1102; Antisense; ATGGAGCTTCAAAACCGCCTATATT
>probe:Drosophila_2:1631442_at:504:201; Interrogation_Position=1114; Antisense; AACCGCCTATATTTCCGATGTTGAA
>probe:Drosophila_2:1631442_at:458:221; Interrogation_Position=1138; Antisense; AAGTGATGCACCTGGCGAGTATCGC
>probe:Drosophila_2:1631442_at:89:79; Interrogation_Position=1173; Antisense; AGGTCCTTAGCGAATTGGGCATATT
>probe:Drosophila_2:1631442_at:479:689; Interrogation_Position=1194; Antisense; TATTGGGCTGCCAGGAACCCGACAA
>probe:Drosophila_2:1631442_at:291:215; Interrogation_Position=1218; Antisense; AAGAGGCCCTGCGATACATCTGCGA
>probe:Drosophila_2:1631442_at:497:317; Interrogation_Position=1281; Antisense; GCCTGGTCACCATTATCAACAAGAT
>probe:Drosophila_2:1631442_at:412:581; Interrogation_Position=1320; Antisense; TGGCCATCGGCATAGACGGTAGCGT
>probe:Drosophila_2:1631442_at:183:105; Interrogation_Position=1333; Antisense; AGACGGTAGCGTGTATCGCTTCCAT
>probe:Drosophila_2:1631442_at:240:401; Interrogation_Position=1370; Antisense; GACATGCTCCAGTACCACATGAAGA
>probe:Drosophila_2:1631442_at:190:613; Interrogation_Position=1389; Antisense; TGAAGAAGCTCCTCAAGCCGGGCGT
>probe:Drosophila_2:1631442_at:632:349; Interrogation_Position=1478; Antisense; GCAGTCCAGGCCAAAAGCAAGCTCT

Paste this into a BLAST search page for me
GAACTTGTACGTTTGGTCATCACCGAAGGGTTTTATGTTCCACGGCATCAATGGAGCTTCAAAACCGCCTATATTAACCGCCTATATTTCCGATGTTGAAAAGTGATGCACCTGGCGAGTATCGCAGGTCCTTAGCGAATTGGGCATATTTATTGGGCTGCCAGGAACCCGACAAAAGAGGCCCTGCGATACATCTGCGAGCCTGGTCACCATTATCAACAAGATTGGCCATCGGCATAGACGGTAGCGTAGACGGTAGCGTGTATCGCTTCCATGACATGCTCCAGTACCACATGAAGATGAAGAAGCTCCTCAAGCCGGGCGTGCAGTCCAGGCCAAAAGCAAGCTCT

Full Affymetrix probeset data:

Annotations for 1631442_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720