Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631443_at:

>probe:Drosophila_2:1631443_at:252:587; Interrogation_Position=203; Antisense; TGGAGAACTCATCGAGCTACACCCA
>probe:Drosophila_2:1631443_at:62:135; Interrogation_Position=223; Antisense; ACCCACAAGAAGTTTGCCGTCAGCA
>probe:Drosophila_2:1631443_at:426:561; Interrogation_Position=297; Antisense; GGAACAGCCGATCTTCAAGCGCCGT
>probe:Drosophila_2:1631443_at:319:205; Interrogation_Position=313; Antisense; AAGCGCCGTCAGACACAGGGATTCT
>probe:Drosophila_2:1631443_at:432:461; Interrogation_Position=332; Antisense; GATTCTTCCGACCTTGGTTGGATAA
>probe:Drosophila_2:1631443_at:213:505; Interrogation_Position=437; Antisense; GTGCCAACATGGTGCGCCGCAGTAA
>probe:Drosophila_2:1631443_at:675:347; Interrogation_Position=455; Antisense; GCAGTAACACCAATCGTCAGCGAAG
>probe:Drosophila_2:1631443_at:383:455; Interrogation_Position=502; Antisense; GATAGAAACACGCTGGCTTGCCTAC
>probe:Drosophila_2:1631443_at:714:517; Interrogation_Position=562; Antisense; GTGGGTCAGCAGTACGAGCAGTATC
>probe:Drosophila_2:1631443_at:584:91; Interrogation_Position=581; Antisense; AGTATCGGAGTCATCATGCCGCCAT
>probe:Drosophila_2:1631443_at:6:115; Interrogation_Position=614; Antisense; AGCAGGTGCGCCTCAGTCTATACTA
>probe:Drosophila_2:1631443_at:150:515; Interrogation_Position=661; Antisense; GTGTTCCAGCGTGCCATAAATCCGG
>probe:Drosophila_2:1631443_at:6:187; Interrogation_Position=713; Antisense; AACAACAGTTCCTCCAGCAGATGGC
>probe:Drosophila_2:1631443_at:368:99; Interrogation_Position=749; Antisense; AGATGCTCATCTTTGGTGGCCAGCA

Paste this into a BLAST search page for me
TGGAGAACTCATCGAGCTACACCCAACCCACAAGAAGTTTGCCGTCAGCAGGAACAGCCGATCTTCAAGCGCCGTAAGCGCCGTCAGACACAGGGATTCTGATTCTTCCGACCTTGGTTGGATAAGTGCCAACATGGTGCGCCGCAGTAAGCAGTAACACCAATCGTCAGCGAAGGATAGAAACACGCTGGCTTGCCTACGTGGGTCAGCAGTACGAGCAGTATCAGTATCGGAGTCATCATGCCGCCATAGCAGGTGCGCCTCAGTCTATACTAGTGTTCCAGCGTGCCATAAATCCGGAACAACAGTTCCTCCAGCAGATGGCAGATGCTCATCTTTGGTGGCCAGCA

Full Affymetrix probeset data:

Annotations for 1631443_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime