Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631444_a_at:

>probe:Drosophila_2:1631444_a_at:591:187; Interrogation_Position=1012; Antisense; AACAGCAAGCCCTTCTATGTGACAG
>probe:Drosophila_2:1631444_a_at:57:21; Interrogation_Position=1044; Antisense; ATATTTTCGCGTTAGTCTGCAGGCT
>probe:Drosophila_2:1631444_a_at:188:435; Interrogation_Position=678; Antisense; GAGGGACTTGCAGTTGGCCATTGAA
>probe:Drosophila_2:1631444_a_at:212:15; Interrogation_Position=706; Antisense; ATATTAGTTGCAAGGGACCGTCCGC
>probe:Drosophila_2:1631444_a_at:398:553; Interrogation_Position=720; Antisense; GGACCGTCCGCATATGGCCAAACAG
>probe:Drosophila_2:1631444_a_at:554:191; Interrogation_Position=765; Antisense; AACTCTCCGAAAGAATGTGGCTCTA
>probe:Drosophila_2:1631444_a_at:695:571; Interrogation_Position=783; Antisense; GGCTCTAAATCAGTTTGGCCAGCAG
>probe:Drosophila_2:1631444_a_at:352:271; Interrogation_Position=815; Antisense; CTCAGTATACTGTGCGGGTTTTTAT
>probe:Drosophila_2:1631444_a_at:522:689; Interrogation_Position=837; Antisense; TATTATGTTTGCATTCGCTGCGGGC
>probe:Drosophila_2:1631444_a_at:221:579; Interrogation_Position=859; Antisense; GGCCTTTTATGTGCTCTTTCTTTTA
>probe:Drosophila_2:1631444_a_at:132:543; Interrogation_Position=897; Antisense; GGATTCCCTCAGCACAATGTACTAC
>probe:Drosophila_2:1631444_a_at:531:57; Interrogation_Position=913; Antisense; ATGTACTACCTTACCCATTGGGAGC
>probe:Drosophila_2:1631444_a_at:539:349; Interrogation_Position=945; Antisense; GCAGTACTCTACAAATCCCAGCGAA
>probe:Drosophila_2:1631444_a_at:336:663; Interrogation_Position=983; Antisense; TAAAGCTCATTAACTTGGCCATTGA

Paste this into a BLAST search page for me
AACAGCAAGCCCTTCTATGTGACAGATATTTTCGCGTTAGTCTGCAGGCTGAGGGACTTGCAGTTGGCCATTGAAATATTAGTTGCAAGGGACCGTCCGCGGACCGTCCGCATATGGCCAAACAGAACTCTCCGAAAGAATGTGGCTCTAGGCTCTAAATCAGTTTGGCCAGCAGCTCAGTATACTGTGCGGGTTTTTATTATTATGTTTGCATTCGCTGCGGGCGGCCTTTTATGTGCTCTTTCTTTTAGGATTCCCTCAGCACAATGTACTACATGTACTACCTTACCCATTGGGAGCGCAGTACTCTACAAATCCCAGCGAATAAAGCTCATTAACTTGGCCATTGA

Full Affymetrix probeset data:

Annotations for 1631444_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime