FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631445_at:

>probe:Drosophila_2:1631445_at:419:491; Interrogation_Position=2968; Antisense; TCCACAAAATGTCACTCCTTTCGAT
>probe:Drosophila_2:1631445_at:664:79; Interrogation_Position=2995; Antisense; AGGGTACCTTATAGATCCGCGGGAT
>probe:Drosophila_2:1631445_at:722:519; Interrogation_Position=3022; Antisense; GTGGATGCCCACTAAGTCACCAGCT
>probe:Drosophila_2:1631445_at:14:371; Interrogation_Position=3079; Antisense; GAAGGAACAATGTCAGCCGGATCAT
>probe:Drosophila_2:1631445_at:478:545; Interrogation_Position=3097; Antisense; GGATCATGGATCCTATCATCATTTT
>probe:Drosophila_2:1631445_at:409:489; Interrogation_Position=3131; Antisense; GTACATACTTCAGACCCAAGTTCCT
>probe:Drosophila_2:1631445_at:281:385; Interrogation_Position=3196; Antisense; GAACATTCGAATGCTTCCAGATGGA
>probe:Drosophila_2:1631445_at:503:441; Interrogation_Position=3215; Antisense; GATGGATTCTATGAACGCACCGTGA
>probe:Drosophila_2:1631445_at:507:131; Interrogation_Position=3280; Antisense; ACCGGAATTTTCACTGCAGCCAAAT
>probe:Drosophila_2:1631445_at:657:551; Interrogation_Position=3314; Antisense; GGAGAACAGCATCCTACTTTCAGAC
>probe:Drosophila_2:1631445_at:16:311; Interrogation_Position=3340; Antisense; CCACGCTTGTCCTTATAGCAATCAA
>probe:Drosophila_2:1631445_at:275:607; Interrogation_Position=3381; Antisense; TGATGATGACATCCGTTCCAGATCC
>probe:Drosophila_2:1631445_at:437:97; Interrogation_Position=3400; Antisense; AGATCCCAATCGACGTTACATTCCA
>probe:Drosophila_2:1631445_at:680:27; Interrogation_Position=3436; Antisense; ATACCCAGCCGAGATGTTTTGGCCA

Paste this into a BLAST search page for me
TCCACAAAATGTCACTCCTTTCGATAGGGTACCTTATAGATCCGCGGGATGTGGATGCCCACTAAGTCACCAGCTGAAGGAACAATGTCAGCCGGATCATGGATCATGGATCCTATCATCATTTTGTACATACTTCAGACCCAAGTTCCTGAACATTCGAATGCTTCCAGATGGAGATGGATTCTATGAACGCACCGTGAACCGGAATTTTCACTGCAGCCAAATGGAGAACAGCATCCTACTTTCAGACCCACGCTTGTCCTTATAGCAATCAATGATGATGACATCCGTTCCAGATCCAGATCCCAATCGACGTTACATTCCAATACCCAGCCGAGATGTTTTGGCCA

Full Affymetrix probeset data:

Annotations for 1631445_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720