FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631446_at:

>probe:Drosophila_2:1631446_at:699:535; Interrogation_Position=1021; Antisense; GGTGCCATGATCTGGTCCCTAGAGA
>probe:Drosophila_2:1631446_at:269:667; Interrogation_Position=1040; Antisense; TAGAGACGGACGACTACCGCGGTCA
>probe:Drosophila_2:1631446_at:631:493; Interrogation_Position=1061; Antisense; GTCAGTGCGGTGAGACCTATCCTCT
>probe:Drosophila_2:1631446_at:718:85; Interrogation_Position=574; Antisense; AGTGCATCCTACGAAATCGCCAACA
>probe:Drosophila_2:1631446_at:287:395; Interrogation_Position=586; Antisense; GAAATCGCCAACATTGCTCAGCAGG
>probe:Drosophila_2:1631446_at:711:619; Interrogation_Position=600; Antisense; TGCTCAGCAGGTCGACTTTATCAAC
>probe:Drosophila_2:1631446_at:338:607; Interrogation_Position=626; Antisense; TGATGACCTACGACTTTGCCATGGC
>probe:Drosophila_2:1631446_at:23:267; Interrogation_Position=682; Antisense; CAGTGGGCCGTGGAGAACGCCATTA
>probe:Drosophila_2:1631446_at:161:609; Interrogation_Position=716; Antisense; TGAGCCAAGGTGCTCCGGCCAACAA
>probe:Drosophila_2:1631446_at:466:669; Interrogation_Position=855; Antisense; TACCGGCTACTTGGGCTACAACGAG
>probe:Drosophila_2:1631446_at:220:105; Interrogation_Position=887; Antisense; AGAACAACTGGCACACCGTTTTCGA
>probe:Drosophila_2:1631446_at:650:609; Interrogation_Position=945; Antisense; TGACCAGTGGGTGAGCTTCGACAAC
>probe:Drosophila_2:1631446_at:405:159; Interrogation_Position=965; Antisense; ACAACGTGCTCAGTGTCCAGTACAA
>probe:Drosophila_2:1631446_at:485:401; Interrogation_Position=994; Antisense; GACTTTGCTTTGTCCAAGGGTCTGG

Paste this into a BLAST search page for me
GGTGCCATGATCTGGTCCCTAGAGATAGAGACGGACGACTACCGCGGTCAGTCAGTGCGGTGAGACCTATCCTCTAGTGCATCCTACGAAATCGCCAACAGAAATCGCCAACATTGCTCAGCAGGTGCTCAGCAGGTCGACTTTATCAACTGATGACCTACGACTTTGCCATGGCCAGTGGGCCGTGGAGAACGCCATTATGAGCCAAGGTGCTCCGGCCAACAATACCGGCTACTTGGGCTACAACGAGAGAACAACTGGCACACCGTTTTCGATGACCAGTGGGTGAGCTTCGACAACACAACGTGCTCAGTGTCCAGTACAAGACTTTGCTTTGTCCAAGGGTCTGG

Full Affymetrix probeset data:

Annotations for 1631446_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720