FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631447_at:

>probe:Drosophila_2:1631447_at:597:675; Interrogation_Position=1036; Antisense; TAGACTCCTCCGACTGGGCGAACAG
>probe:Drosophila_2:1631447_at:246:451; Interrogation_Position=1119; Antisense; GATCTGAGTGTCATGCTGCCGGAAA
>probe:Drosophila_2:1631447_at:257:627; Interrogation_Position=1135; Antisense; TGCCGGAAATGTCGCGCTTTGTCAC
>probe:Drosophila_2:1631447_at:462:341; Interrogation_Position=1150; Antisense; GCTTTGTCACCACCTTTTGAATGCA
>probe:Drosophila_2:1631447_at:211:143; Interrogation_Position=674; Antisense; ACTGACCATGGCGTTGCTGGGAAAT
>probe:Drosophila_2:1631447_at:515:237; Interrogation_Position=723; Antisense; AATCGATTGCGACGGCTGCCCAGGA
>probe:Drosophila_2:1631447_at:317:283; Interrogation_Position=768; Antisense; CTGCGGTTTGCTTTTCTCAACGAAA
>probe:Drosophila_2:1631447_at:561:721; Interrogation_Position=794; Antisense; TTGTATTGACGAGATGCCCACGCGG
>probe:Drosophila_2:1631447_at:476:437; Interrogation_Position=828; Antisense; GAGGAGTTGCGGACTCTTCACATGC
>probe:Drosophila_2:1631447_at:714:649; Interrogation_Position=845; Antisense; TCACATGCTCAACCTGTCCAAGAAT
>probe:Drosophila_2:1631447_at:622:259; Interrogation_Position=882; Antisense; CACCGCGATCTACAGCTAATGGCTT
>probe:Drosophila_2:1631447_at:181:693; Interrogation_Position=905; Antisense; TTTGCGCCAGACGAACCTTTATGTG
>probe:Drosophila_2:1631447_at:201:129; Interrogation_Position=919; Antisense; ACCTTTATGTGGAGCTGCCGTCAGA
>probe:Drosophila_2:1631447_at:628:243; Interrogation_Position=951; Antisense; AATATTTGCGATGGTCTCGCCAGTC

Paste this into a BLAST search page for me
TAGACTCCTCCGACTGGGCGAACAGGATCTGAGTGTCATGCTGCCGGAAATGCCGGAAATGTCGCGCTTTGTCACGCTTTGTCACCACCTTTTGAATGCAACTGACCATGGCGTTGCTGGGAAATAATCGATTGCGACGGCTGCCCAGGACTGCGGTTTGCTTTTCTCAACGAAATTGTATTGACGAGATGCCCACGCGGGAGGAGTTGCGGACTCTTCACATGCTCACATGCTCAACCTGTCCAAGAATCACCGCGATCTACAGCTAATGGCTTTTTGCGCCAGACGAACCTTTATGTGACCTTTATGTGGAGCTGCCGTCAGAAATATTTGCGATGGTCTCGCCAGTC

Full Affymetrix probeset data:

Annotations for 1631447_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720