FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631448_at:

>probe:Drosophila_2:1631448_at:598:257; Interrogation_Position=1024; Antisense; CACAGCCAGGTCATCCAGCGGAGGG
>probe:Drosophila_2:1631448_at:24:419; Interrogation_Position=1051; Antisense; GAGCGGTGTCACTGTAAATTCCAAT
>probe:Drosophila_2:1631448_at:510:613; Interrogation_Position=551; Antisense; TGAAGACGTGCTGGAAGTCCGCGCC
>probe:Drosophila_2:1631448_at:135:633; Interrogation_Position=568; Antisense; TCCGCGCCCGATTTTCACATTGTGG
>probe:Drosophila_2:1631448_at:449:507; Interrogation_Position=598; Antisense; GTGCTGAAGCACCAGTTCCGCAAGG
>probe:Drosophila_2:1631448_at:367:227; Interrogation_Position=619; Antisense; AAGGCCATTCTGGTGGATCAATCGA
>probe:Drosophila_2:1631448_at:80:535; Interrogation_Position=666; Antisense; GGTCGTTTTGAAACGGGCGCGCAAT
>probe:Drosophila_2:1631448_at:589:155; Interrogation_Position=740; Antisense; ACAGCACGGATGCATCTGGTGGCCA
>probe:Drosophila_2:1631448_at:388:369; Interrogation_Position=852; Antisense; GAATGCGGCACGAATGGCCCGAAAA
>probe:Drosophila_2:1631448_at:709:551; Interrogation_Position=879; Antisense; GGAGACATCGCTGTTCTACTATCAG
>probe:Drosophila_2:1631448_at:237:323; Interrogation_Position=909; Antisense; GCCCAACTTTTGTGAGCGCGATCTG
>probe:Drosophila_2:1631448_at:150:125; Interrogation_Position=923; Antisense; AGCGCGATCTGGGAGCTGATATACA
>probe:Drosophila_2:1631448_at:292:21; Interrogation_Position=941; Antisense; ATATACAGGGCACCGTGGGACGCAA
>probe:Drosophila_2:1631448_at:415:85; Interrogation_Position=965; Antisense; AGTGCAATCGGAACACCACGACCAG

Paste this into a BLAST search page for me
CACAGCCAGGTCATCCAGCGGAGGGGAGCGGTGTCACTGTAAATTCCAATTGAAGACGTGCTGGAAGTCCGCGCCTCCGCGCCCGATTTTCACATTGTGGGTGCTGAAGCACCAGTTCCGCAAGGAAGGCCATTCTGGTGGATCAATCGAGGTCGTTTTGAAACGGGCGCGCAATACAGCACGGATGCATCTGGTGGCCAGAATGCGGCACGAATGGCCCGAAAAGGAGACATCGCTGTTCTACTATCAGGCCCAACTTTTGTGAGCGCGATCTGAGCGCGATCTGGGAGCTGATATACAATATACAGGGCACCGTGGGACGCAAAGTGCAATCGGAACACCACGACCAG

Full Affymetrix probeset data:

Annotations for 1631448_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720